Description :
From Genome Similarity Track
Location :
Scaffold_2823:64- 1180
Transcript NameFunction/comments
Phyra_46396DEAD/DEAH box RNA helicase, putative

Sequence
1116 bases(100 bases per row)
ACGTGTTCAACACTCGCACAGGAGCAACGTTTTGGGAACTCCCACAATTCGCTTCGTGAAAGTACTGCCAGGTTGGGTGTGTGCAAACAAACGAATAGTA
TTATCCTCTATCTCGAAATCAATGTCAGGCTGCTCGGAACACGAGCCTAATACATGCAAATCTAGCGCCGGGCGCGGTGCTGGGCTCTCTGCTGTGCGCG
TTGCACGTGCTGAGCTTTCTTGCGTTTGCGAATACGCTCCTCACGTTTGGCAGCTTCGCGCTTCTGCAAGCCCGTCTTCTGCACTGCCTGTTCCTTCTTC
TTGAACCGCTCCTTTAGCTTTTCTTCCGAACGTTGCCACTTGGACTTCTTCTTTTCTCCATCTTCGTCATCGTCACCATCATCGACTTCAGAATCGTCCG
CCTTACCCAGCAGCACCTTCTCGTATTCCTCCTCTGTGATCTTTCCCTTCTTAAGCTTCTTGTACAGCTTCTCTTCCTCGGCCAGCTCATCCCATTCTTC
GACAATCTGTTGGTGCAGGCCTTTCTTCTTCTCACGACGACGCGGTTGCTTCTGGTTCTCCTCTTCCAACGGACGCTTGCGCTTCTTCTCGCGCATCTCA
GCGTTCTTCTTGTCACGAGCTTCGTTTTCCTTCGCAATCACAACCAGCTTCTTCTGGCGCTCTTTTTCACGAGCCTTGTCCTTGAACTTAATGTCAGTCG
TCTTGATGTCAGTCTTCTCGAAGTTAATGCGCACGTTACGCAGCTCGTTGATCTTGGGAAGCTGCAGCAGACAGAAGCCGCGAGCGACAGCTCCCAGGTC
AAGCTCCTTGAAGCGGAATATGAACTGACACTGGTGCTCTTTGTACGAACGCACAAATGCCATGAACGCCTTGGTTCCCTTCTCGAGTAGGTCACGATCT
TCCAGGATGAACGACTTCACATTGGGCAGGACATCCTCCATCGTGTCCAGCGGGAGTGTCATCTCTTCGCACGGCACCTTACGGATCTTCAGGAAGTTCA
CATACGCGTCCTCGTTCGAAGACAAGAAGGACAGGGCGCATCCAGATCGGCCTGCACGTGCTGTACGACCCACTCGGTGCACGAAGAAGTTCGGGTCCTG
CGGCGGATCGTACTGC