Description :
From Genome Similarity Track
Location :
Scaffold_110:63985- 66732
Transcript NameFunction/comments
g18618.t1hypothetical protein

Sequence
2747 bases(100 bases per row)
ACCGAGTTCAAGTCATCATCCTCTCCATATGTGACCCTCCCCTTGTTTACGTGTCATGGTACTCGCTTGCATTTTATTATGGTAGTCCACCATCTCCCCC
GCTGATCGTTCAAGTACGTCAGCAGCTACCATGCCGAGGCAGCGTCTGATTAGCCTCCAAGGCACTTAACCTGTCGTGCAGTGGACACAATCAGCACCAT
GACCCCACCGCTACGACACTCTGCATGACTCCACCACACCGTCGCTGGGCCCGCGCCTCGCACCTCCGACCTCACAACTCAAAAGTCTCCTCAAGACACA
AGCCTCCCCCACTCCCCACCCCACTCATGTCGACCTACACCAAATTCGCCATCATCGCAGCCGGCGGCGTCGGCGGCACCGTCGCGGACGAGCTGCTCAA
GAAGGGCGACGCCGTGTCCGTCTCCATCCTCACGCGCGACGAGAGCAAGCCGGAGCTGCAGGCCTTCAAGGCGCGCGGCGCCACGCTGCACCAGGTCGCG
TACGACGACGAGGCCGCCGTGGCCAAGGCGCTGGCCGGCAGCGAGGTGGTCGTGAGCACCGTGTCGCCCTACAACATGGGCGTGCAGAAGTCGCTGGTGC
CCGCGGCCAAGGCGGCGGGCGTGCAGCTCTTCGTGCCGGCCGAGTACGGCGTGCGCGTGACCGAGGGCCCCAACGTGACCAAGAAGGAGGTGCAGGACCT
GCTGACGCAGCACCAGATCCCCTTCACCATCTTCTACACGGGCCTCTTCGCCGAGTTCCTGCCCTACTTCCTCGACTACCACTACGCCGACGGCTACATG
AACGTGGTGGGCAAGGGCGAGACGGCCTTCAGCATCACGGCGCGCTCGGACGTGGGCCGCTTCGTGGCGCACGTCGTGTCCACGGCGCCCAAGAGCGCGC
TGGCAGGCGCCAAGATCCCGTTCGAGGCCGAGCGCCTGTCGCCGCTGCAGATCCACGCGCTGGCGGAGAAGAAGCTCGACAAGAAGATCGAGGTGCGCCA
CGTGGACTTGGAGGAGAACCGGAAGAAGTTCGACACGGACTTCGTGGCCTTCCTCACGACGCTGTTCGAGGAGGGCCGCGGCGTGGCCGGCACGGAGCAG
GAGGTGCAGGAGTCCGTGGCCAAGTTCTTCCCGGACTGGAACCCGAGCCTGTACGAGTCCTTCATTGCGTAAGCGACGAGCGGCAGGCAGTTCACGTAGC
AGTAGGATATCTGTGTGCGCCGCCAGTATAATACAAGATGCGATGCAAAGTTTATCTTCTGAATGAGTTTTGGTGCTGTCAAGGAGGCTTGAGTCGTTCG
TCGCACCAGTGAAGTGTCAAAATTGCTTTGCGCTGCTGAAATAGTTCTTTCCAGGATAAAAGTTAAAGTAAACAGCTTTTCACCCTTAAGCGAACTCCAA
CGGCTCCTAGCAGGATTAATGCGAGAACTATCCTGAAGTCAAGTGTTTTCGTTTGTTTTTAGACACGAGAGCGCAAAGCTCTGCGTATTCAGCTACGTCG
TTCTTATGCTTCATGCTAACCGAAAGAGGCTTTGCTCGTAACTGTGCGATCGTCACTGTTGAGCCAAACCTAGCTGCCACTCAAGAATAGTGATACACCA
GGTATTTTGCTGCCAGCCTGCCTACTTCACATTCGGTTATCGGTTCACTTCGGCAGACAGGTATAGATTGTCGACGTAGGTGCACCGTGGTCTACGCCCA
AATGAAGCGAGAAAGCAGCGGCACCATTGAAATGAACAAGCCTACGCTCGACAAACAGCCTTCGCAAGAAAACACACGAAGACGGAGCAGTCTAGCTGAC
GTGGCCAACTACCTGCACCAACATGAGTTCCACGACTACGAGATCTCGTCCAGAACCTGCGTGGCTATCTTCCTGCTCGTCTTCGTGGGAGTGAGTTTCA
TCCCATTCAAAGAGTATTACCTGGGAAGCTACGTCACCAAGCCGTTCGATGAAGTCCGAGACGAGAAGGCAGCTCGAAAGCTCAACCAAATGGGGGTCGT
TGTCAGCGGTGTCCACTACTTCGACACGTTTGAGCGGTCGCTGCTCCCTCTCATCGATTTGGACACCAAGACGGATCTTACACGGTCCACAGCACTTAAT
CTCTCGCTGACCGACTTCCTCGTACGAGCAAACATCCGTAGAGACGACCTCCTCGCCGGCCTACCGGAAGAAATGTTGGGGCAGCCGGTAGATCTCATGG
TAGACGTGTTGGCGCCGTTGTGCGGACCTGTGACGGACTCGACCTCATCTTGGATAGCGCAGCCCCAACTTTTGTTCGGCAATTGGTTCCCCGAGATCCG
CCACGAGTTTTGTCGCGACTTCCACGACAAGTTTGGGCTCGATCGGTTCTTCAATCGTGGCAGCAAAGCGCCGACCGATAAGAATTTAACTCACGTGGGC
GAAGTTACACTCGGTCTCATCGCAGTTGTGAACATGTCGGAGGTGTACTTGCGCCACTTCAACGACGCTCTGGTGGTTCGCAAAATCATGAGAAACGTGC
AAGAGGGCTACATGGACTTAGACTTGGCTGAATACACGGATGCTGTTGCAGAAGCGATTGTGGATCGGTACAGCAAAGGCATCTCGCTAGCCGACGTTAT
CTCCTTACTACCGGGTTCCTTCGATGCAGCTCATGTGGCGCTGGTCGACGTGCTGGGGGTCAAAGCGCTTCTCGCCCACTATCTTGAAACGCAGCAGCTG
ACAATGGGGGTAAATGTGAACGGAGAGGCTGCGATTTTGGCTGAGGT