Description :
From Genome Similarity Track
Location :
Scaffold_51:639646- 647796
Sequence
8150 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTGGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTA
CCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACCACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGG
GATGGAGGCCCTGCAGAGCCTGGTGGTATCAGCACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTG
CGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAAGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACC
TTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCG
TGCTAAGAGTTGGGTGTACACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCG
AACTACGAGTATCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACGAAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGAGAGCTCACGGCGTCC
CTAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCGCTCAGCTGTTCCGGGTGCAGTCAA
GCACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATAGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGC
TCCCGGTCGGGCAAGCCCCAACGAACCAGGTTCCCATGGAAGTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTT
CAAGCGCGACTGTCCCGCGGAAGACTCCGCAGACGGTCCTTCCCCAAGCTCGTCCTCAAGGGTCGCTGGCAGACGCCAGGATCCCGGGGACAGGGGAACG
CAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGT
CTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGATTGACTCTG
GGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGT
GCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTC
GATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTG
CGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTT
GGGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGAGTAACTTAGGTCCACAGGCGGGT
AACTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTG
AAGAGGAAGACGTCGGATACGCTTCCTGTGTGAGTAACACAGTGCCCCACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTG
TGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACCATAGTACCACACGAGGCC
ACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGATGTGGGAAGCAAAGCTCCCCGTCACAGACGCCGTCGACAAAGACGCCGCCGCCGCCTCAAGT
CGGATCCGAACTTCGTTCCGATCGACGTCGCCTCAAGCGACTCGAAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACTTCTT
CGATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCATTTGGATCCGTTGCCAGAGGTTGCAGAGATACTGAACCTCATGGAAATGACGGCTGAG
TCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACG
AGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTA
TGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACG
AGGCAATGGCCTCACCCGCGCGAACTGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCAAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACT
CGACACCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGAT
CCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGT
AACATCCCGCTCACCGCGGTAAGCACCCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCTGCAGGGTTTGTCCAACGCCCCGGCGACGTTCAATCGCC
TGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAGACGGCCATGCAG
CTGCATCTAGACACCTCCGTCGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCC
AAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGA
CACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCTAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAA
TATGCCCTTGTGAAGTTCCGTGTTCATCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACC
TCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTC
TAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCT
ATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCC
TCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTC
CAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGT
GAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCGCTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGCCTTGACTTCA
TCTTTGGGCTTCCCGCCGACGGACACGGTAACACCGGAATTTTGGTGTTCGTGTGTCGTCTGAGCAAGATGTACCATCTTGCTCCAGTTCCCGTCACTGT
TACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCTGCTATCACGGTCTCCCAGAGACGATTGTCTCGGATCGAGACCCGCGGTTCACTGCT
GCGTTTTGGAAAACGCTTTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAG
TGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCGCCACGTACGTGGTCGACGCAGCTTCTAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTC
CACGGGTCTCACGCCGTTCTATTTGAACGGCTTCCGCCACCCCAGCGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGAGGAGAGG
CTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTTGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAGCATTGTCAGCAG
GGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGTGACTTAGTG
TTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTTGGCAGCAGCAAACTGAAGCACCGCTCCATCGGACCTTTTGCAGTCCTGGCCAGAC
ATGGTGCGTTGTACACCATCGACCTTCCAAAGTCAATGAAGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGC
TGACTCGCAGCCCCCCTTGACCCAGCTCTTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGC
AAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCG
TACGCCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATTCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCC
GGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTCGGTCCCGGCCTGGGCGGC
AGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGA
GCGCTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAACGGAGACGTCCACTTCCAC
GTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAGCTCGTGGGAGCCGATTG
AACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACG
GTCGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGC
AAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTAATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTGAGAGTCTCCACC
CATGCCCAGAACATGTCCTCACAAGAACTCCTGGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAGCAGGATAGAGACCACCCCGGGTCTCGG
GCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACGGTTCTTT
CTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGTCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTC
TCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAGCCCCCACGCACACGCTGGGCAGCTTGGAAATCCT
CCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTC
GAAGATACTCCGATAGGAGCGACGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGACAGTACGCTTCTTTGAGGGCTTGGCGTCTTCAGCTTTAGAG
GCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCCCTTCCTCATCGCCACCGGCTTTAGGAGCGTCCTTAGCCTTGACGGCCG
GACTCTCAGAGCGCACAGAGGTCCTAGGACTGTGATCATTTTGATCACTAGCGGGCGACTGCACGCTTTCATCTTTATGTTCACTGGGCACTGGGCTGTG
CCCTCTCACAGAGCCCGCAGGAGCATCATGAGTGCTCCCGGACTCGGCATCGTCCTCACTGTCCGAGTTGAACTCACGTACTAAGAACCGAGGGTTCGGA
CGATTGTCTGAAGATGAGGGCGACCGGGCTGCGGCGCTTCTTGCGCACTTTTCCCGCAGCCGCGTCACCCGAGGATTCGATCGCCTCGGAGGCCACCTGA
GTAGCCTCCTTAAGTGCAGAGACTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAAACTTGGAGCGTGTCTTAGCAACGCTCTTAG
CAGTACCACGAGGCATGTTAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGC
TCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAG
GATATAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGAGATATTTGGTA
CAAGGTACCAAGGTCGTTCAAAGCCAACCATTATTTAAATGACATTGCATTTCTATAGGTAACGAACAGTTTGTATTAAACCCAAACTTAACCTACCTAT
AAATATACTCAGTTTTACAATCTACCTTATTTGGGTCACTTCGCTCTCTTTAATTAAAGAGGGAACCTGTGAACAGCCGTTCACTGAGAGTTTGTATACT
CTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAT