Description :
From Genome Similarity Track
Location :
contig_5:639577- 640644
Transcript NameFunction/comments
g1417.t1hypothetical protein PHMEG_00019519

Sequence
1067 bases(100 bases per row)
GAGCGTGAGCAAAAGCGGCGAGAAGAACTATTTGCAAAGGAGCGTACGCGAAAGCAACGGGAAGCTGATGAACAGCGGCGACAACAAGAGATTGAAAGAG
CGGAGCAACACCGCTTGGATCTCGAGCTGGCTCGCAAACGAGCTGAAGAGCAGCAGAAAGAGATAATGCGCCGTGAGCAGCGTGTTAAACAAGAAGAAGC
CCGCAGACAGCGCGATGCCAGCTCAGTGAGAAAGAGCGTCTACGTCACCAGGAAGAGGCGCGAATGCAGAATGAGCTGTACCAGCTTGCCCAAGAGCGAG
AGGCAACACGGAAGCTCCGTGAAATGCAGGCTCGCGAAGAGAAGCTTACGGAGGAGCGAGAGCGCCATAGGAAAGCTAAGGCTCGGGAGCTGGAAGAAAA
CAGGCGCGCAATACCGAACGCATTGCACTTGTGCTGCAAGAAAAGGACCTGCAGCGCAGGGCTCAACTCGAAGAAGCGGCCCGTAAGCATCAGCAAAGCG
AGGAACGCCGCCAAGCCTTTGAGGAGGAGCGAAGAGCGAAGGAGGAAGAAGTTCGACTTCAAGCACAACGCAAAAAGGAGGCAATCGAAGGTGTTCAAAT
CCAGTTAGCGTCAAATGAGGCGCAGCGGCGTGAGCGGCTAAGAGAGCAAGAGCGTCAAGCCCAGCTGCGGTTGATGCAACGAGAACGGGAGAAACAGCAG
CAACTTGAGGCTCAACAGCGCGAGGAAAGGCGACTGGAGCGTGAGCGGCGTCGGGCCTATGAACGCATGGAGTCTCAACTACAAAAGAAGCAATCAGCCA
TTCTGCGCAAGACGGAGGAGAAAGCGGCGGTAGCGCAAATGATGCAGAAGCAGAAGTATGCATCTGTGCGTGCTCGACTGCTAGACGCAAAGCTTCGGGA
GGAAGAAATCCAGACGGCGTTGATGCGCAAGAGCAAGCAAGACGAGTATCGTACAAACCTGTTACTCTCTCGTATTGAGAACGATAATGAGCGTACGCAG
CACCTCAAGCAGCACCGCACCGACCTTATTCGTCGACGGCAGCAGATCAAGCAAACTGCCAACCGCC