Description :
From Genome Similarity Track
Location :
contig_29:639355- 642246
Transcript NameFunction/comments
g7227.t1hypothetical protein

Sequence
2891 bases(100 bases per row)
TGCAACAATAAGGTGATAACGGCCAAGTACACCAAGCTCAACTTCATCCCGCGGTTTTTCTACGGGCGGCTCTCGCAGGTGGCCAACTTCTACTTCTTGC
TGGTCGGTGCAGGCCAGATTATCCCCGAGATCTCGTCAACGCAGACGATCCCATACCAGTGGATCGTTCTGATGCTCGTCTTGTCGATTGATGCCATCTT
CGCCGCTATCGAAGACCGCGGTCGGCATGTAGCGGACGGCAAAATGAATGCTCGTGTCTCGCACATTTTCGATTTGGACGAACCCGATTGCTTTCGTGAC
GATACCTGGCGGAACGTCGCGGTGGGGAACATCATCAAGATCGAGAACTACGAGGCGATTCCAGCGGATGTGCTCTTGCTAGCGGTTTCTGAGCCGGACT
CGAATGCCCCCACGGGTATTTGCTTTGTAGAGACGAAATCGCTTGACGGTGAGACGAATCTCAAGGTCCGACAAGCACTAAGCTGTACGTTTTCGCAGCT
CAGCGACCCTCGCGCGCTCGCCCAGCTTCCTGGCCGTGTGATTTGCGAAAAGCCCAACCACGATGTCAATACCTTCTCCGGACGCTTTGAACCGCACAGT
GGACATGCAATCCCGATCGACCTGAAGAACGTGGCGCTACGTGGTTGTGTAATTCGAAACACAGCATTCGTTTATGGACTTGTCCTGAATACGGGCGGCG
ATACCAAGATCATGCAGGCCGGGTCACACACTCCTCCCACCAAGATCAGCAAGATCATTGCCATCGTAAACCGCGGCAACGCCTTGCTCATGGCAATCCT
CGGTTCTTTGTGCATTCTTGGTGCTGTGCTGTGCGCATTCTGGGTTGCGGAAAATCGCGAAGGCGCCACGTACTTGCACCTCGAGAACCTAAGCGGCGTA
GCTCCTTTCCGCAACGACGTTGTGGGTGTGTTGATTTATCTGGGCTACTACTGGATCCTGGTCGCCTCGTTCGTTCCCATTACGCTGTATGTGACCATCG
CCATTGTCAAGACGTACCAAACGTTTTTCTTGAATCGCGATCTCGGAATGTACGACGAAGTTACCGACACACCGGCATTGGTGCGTAACTCGGATCTGAA
CGATGACCTTGGCCAAGTGACGCACATTTTCAGCGACAAGACCGGCACGCTCACAGCTAACGAGATGGACTTCCGCAAGATGAGCATTCATGGCGTGTCT
TACGGACGAGGCACCACAGAAATTGGCCGAGAGGCTACGCGGCGCCTTGGTAAGGATTTGTCTGCCAGTGATGTGCTAGCGGACAATACTCCAATTCTTG
AGAAGACGAACAATGTAAACTTCCTGGACCCGGCCGGAGATTTGGAGCGAGACAGCGACGTACGTCTGCACCCGGAGCAGGCAGCACGCATCCATGACTT
CTTCGTGCACCTGGCAGTCTGCCACTCGGTTGTGCGCGAGACGTTGGCAGAAAATGACACGGGTACAGGCTTCTCGGCTTCGTCCCCAGACGAGCTCGCA
CTCGTGTCTGGCGCCAATTACTTTGGCTATTCGTTCCGTGCTCGTCGGAACGGTGAAGTGGCCATCGTAGTCCCTGGAAGACGTGAAGAGGTGAGTTATG
AGCTGCTGGAAATGGTCGACTTCACTAGCACGCGCAAGCGAATGTCTGTGGTCGTGCGAACGCCTGACAAGCGTGTCATGCTGCTCACGAAAGGTGCCGA
CTCCGTTATCTTCCCCCGGTTAGCTCAGTCGTCAGATTCATCGATTGTAGACACGACACTGATGCATCTCGAACGCTATGCAACCGAGGGTCTACGGACA
CTTGTGATCGCGCAGAAGGAACTATCCCCGGAAGTGTACGCTGAGTGGTCTTGCGAGTACGATGCAGCATTAGGCGATTTGGAGCAAATGGCAATGCAAC
GGCGCGGTGAGCCTAATCGTATCGAGGAGCTTGAGGAGCAGCTGGAGCAAGGATTGCAGCTTATAGGCGCTACGGCTATCGAGGATCGTCTGCAGGACCA
GGTCACGTCCACGCTGGGAGACTTGGCGCGAGCAGGCATCAAAATCTGGGTGCTCACTGGCGACAAGGAGGAGACGGCCGTGAATATCGGCTTTGCATGC
CAGCTACTCGACAATGACATGGAACGCATCATGATTAACGCCGAGACTTTGCCGTCAGCCTCGGATCTCTACGACATGCTGCTGTCTCGCTGTGTTGAAG
CTCGAAAGCGTACGGAGCGACAGGCGAAAGGAGCAAAAGAGGAGTCGCGGCCCCAAGCCATTGTGATTGACGGCCGAAGTTTAACGATGGTTTTCAGCAA
CAACGTGCTCTCGGAGCTGTTCCTTGAGGTCTCCCAGCAGTGCGTCTCCGTCATTTGCTGCCGCGTGTCCCCCAAGCAGAAAGCGCAAGTTGTTCGCCTC
TTCAAGTCGAATCTGCACGGTTGCCGCTCGCTCGCCATTGGAGACGGCGCAAACGACGTTGCCATGATCCAAGAAGCGCACATTGGCGTCGGCATTTCGG
GACACGAGGGGATGCAGGCGGTGAACGCAAGTGACTTCGCTATCGCTCAGTTCCGTTTCCTGAAGCGCTTGCTACTTGTCCACGGCCACTGGAACTACCG
GCGCATGGCGAAGCTGGCGCTGTATGTAGTGTACAAGAACATTTTGCTGTTCGGTACCGAGTTCGTGCTGGCTGTCCTGCCCCAGTGTGGGTCGTCCGGC
ACTCTGTACTTCAACAACATGTGGATCAACGGCTACAACGTCTTCTGGTCCTCGATGCCAATCGGAATTGTGGCAATCACGGAGCAAGAAGTCCCCGCGC
GCATCGCAGAGCAGTTCCCGGGGCTTTACCATGTCGGCGCGCAGGGCGAGTTGTTCAGCTTTCGTATTTTCGCGCAGTGGGTGGCCGAGGC