Description :
From Genome Similarity Track
Location :
Scaffold_283:6392- 17362
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_283-fgenesh-gene-0.1Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_283-snap-gene-0.15G patch domain containing 1
Pytve_DAOMBR484maker-pve_contig_283-snap-gene-0.21Nucleolin
Pytve_DAOMBR484maker-pve_contig_283-fgenesh-gene-0.3Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_283-fgenesh-gene-0.4Pc22g18030 protein
Pytve_DAOMBR484fgenesh-pve_contig_283-abinit-gene-0.84Xenotropic and polytropic murine leukemia virus receptor ids-4

Sequence
10970 bases(100 bases per row)
TGCGCAAGTCGCTGTCGATGCCGATCGGGCAGCCGCGGCTGCGGCGCCGCCGCTCGCTGCAGGACGACCTGTTCGCGCGGACGCAGTCGTTCCCGAAGCG
CCGGCTGGAGCGGCACTCGTCGCAGGGCATGGGTGGTGGTGGTGGCGGTGGCGGCGGTGGTGCGCTGCCGAGCGTCGAGGTGGCGCTGCTGGAGCGCATC
CAGGTCGAGTTCGTCAAGGCCGTGCTGCCGGCCAACAAGATGGCGAGCACGCGGTACGTCATGCGCGTGGCCAACCAGGCGCTCAACCAGTCGTGGGAGA
TGTCGCGCACCTTTCGCGAGTTCTACGAGCTCAAGGAGGCGATCGTGCGCGCGCTCGACCACGGCCACTTCTGTCCGTCTAATTGCCCGTGGCTCTACAT
GTACGTGACGCACCACTTCCCGCGACGTCACGTCTTCCGCTCGCGCAGCCCCGCGGTGATCTCGAACCGCCTGTGCGAGTTGCAGAACTTCATGTCGACG
GTGCTCGGCACGTGGAAGGAGAGCCGCTCGTTGGACTGCGTCGTCTCGACCTCAAGACTACCCCGGCTGCTGTACGACTTTCTCTTCCAAGGCATGGTCG
TCGACCTCGCGGACCTCAACAACAGCGCGCTTGCGACCGAGCGCGCGTCGTTCGGCCGCGGATCGCTCGGCGGCTCGTTCGTCGAGACCGGCGCGGGCTG
CTCGGATGAGGAGTGCTCGATCTGCCACCTGCCGCTCGTGACCCCCNNNNNNNNNNNNNNNNNNNNCGATCGCGCCGGCGAGCAGCAAGGAGAAGAACCG
CACGGCCAGCAACGGCAGCGTCGACACTGCCGAGACGGTCGACACGTCCGAGAACGAGATTTCTGCCAGCGTGATGGCCTCGCTCACGACGCTCGCGTGC
GGCCACTGCTTCCACGACGAATGTATCCTGCGCAAGCTCAATGAGTCGCTCACGTGTCCGCGGTGCGAGGCCGACAGGCCCGAGCGCATGGACGGCATCA
GCGAGTGATGCAAGCTGCAAGGCGAGCAGCGAGGGACAGCCATAGGAAATGCAGCGTCAATTCAATTGGTGTCATGTTCGTTGATTGTGAGTTTCATGCC
ACGTCCTCGTCCATTGGGCGACTCGACAGCGAACCTGGGGTGCTGGTTGGCGTGGCCGTTCTCGTCCAGCACAAATTGATGCCATTCGTGTCACATGAAC
TGCGCCTTTGCTGAAGCAGTCACATTCTCAGATATCCGAGAATAAGGAGGACCACACTAATTTATGTATAGTGTGGTTGACGAAATGAACCCTATTTTAG
CTGTCAGTGTTTCCTTTGGACAGATCATCAGCGTTGGCGACGCCATGAAGCGGAGTGCGCTTGCTCGGTCTCAAGAGGTACGACTCGGTGGACGGCGGCG
AGCAAAACCGCATGCCAAAACTGCTCCAAGTATTGCTTTGTGTGTGCACGCGTCGGCGCTAACGTTTTTGCGGTCTATCTGCGCGGCGGTAGGTGACGGA
CAGCGAAGGGCGGCGGCGCTTCCATGGCGCCTTCACGGGCGGCTTCTCGGCCGGCTACTTCAACTCGGTGGGCAGCAAGGAAGGATGGATGCCCGCTGCA
TTCTCGTCTTCGAGGCAGGACCGCGCGTCGCGGTTCCAGCAGCGCGCCGAGGACTTTATGGATGAGGAGGACGACCCGCTGCTCGGCAAGCGGCTCGAGA
CAACCGAGCAGTACGACACGCACCAGGCCGGAGCCAAGCGCGCGTTACAGCAACTGGATGCCCATCGACAACAGTCAGTCTCGGCGTCAGCATCTATCCC
AGGGTTTGCATTGCCCGATGAATGGCTGCTCCCGGCCAACAACTCGATCGGGGCGGCGCTGTTGAGGCAGATGGGCTGGAAGGATGGCCACGGCATTGGC
CAACGTGTCCGAAAGAAGAAACTCGGCAGCGCGACAGCACCGGTGGCTGGCGGTGAGGATCTTGCAGCTACTCAAGGAACTGTGGGGGACGGTGCAGACG
ATGACGTCGAAAATGAGGAGGTGTATGTTCCGCCGCGCAACTCGATCGATGTCAAGACGGCATTTCCGCAGCCCAAAGTGGATCGATACGGCGCAGGATT
TGACCCGTTTGTGGACGCCCCCGAGTTTCTGCGGTACAAGGAGCAGCAAGGAGAAGACAGGACGGCAGGTTCTCGACAAGTTGTCACTTTCGCAGATGCA
ATGAAGCAAACGACCGGGAGCAACCGAGCGACGACAGCGTACGGACTCAGTGCGCTCGAGGAGAACGACGACATTGACGTGTATGGGACGACGTCGATGA
ATGAGTTTGACACAGAGATTGGTCCGCGCAGCGATCGAAAAGCTCGTAAGCTGCTGACTGCACCGACCGGAGCCGACAATCAACAGAAACGACGTCAGCG
AGCTGTGTGTTCGGATGGACGGCATGCGCTGCCTGGGTTCGAGGTTGCGTCGGTGAAGGCGAAGCCCCCCAAAGCGGTCGCTGCTCGCCTGCCAGTTCCA
CCCAATTTCAAGCCGTTCCATCGTTTTGACGACAATGAAGACGATGGCGCGAATGCTGTGAGCGCTTTGTATCGAAGCCACAACTTTTCGACACTGCAGC
ACGGACGAAGCACTCCCATGACTGTCAAAGAACGAGCAGTGCTACTTGGTGAGTCGAAGGCACCACAAGAAACTGCGTCAACAGCCAGCGGCAGTGTATT
CGATCTCCTGTCAAGCTCAGACAAGCAAAAGCTGTTGGCTTCTGCGTCGCAAGCGAGGGCGGGGAACGTACCGAGTACTGCACGGACTAATTCGTCCGAG
GTCGCAGTGCAAAATCGACAGCCACTTGTTGACGGAGCATCAAGCGACCAGTTGCGAGCGACGATATCAGCATCGATTGCCAAACGATTCGTGCCGTCGG
CCCAGCCATCAGCTGCTTCAGATGACACGTCGGTGGACCAGCAGACTCTCGCCAAGCCTTCGTATCGTTCTCAAAGCCAATGGATCCCAAGCTCGCTGCT
GTGCAAGCGCTTCCACGTCAAGTGTGCTGGACAGACTAGTCGATCTGAAGTGTCCAACTTGGACGACCCTCGGCCTGATCTCTTTTCACAAGAGCTAGTT
CCTCAGTTAGTCGAGTTTGCCGCTGGTCGCAACTCGAATGCTGGAGCCCGCGTTGCTCCTCGCGCAGACCCAGTCCCGAGTGCCCACGCTCTGTCCGACG
ACAAGGAGCTTCCGCCTTTACCGGTTGCAGCTCGGCCAGCAGCGACATTGCTCAAGTCGATCTTCGACCCGTCGGACGACTCGGCGAGTGAAGAGGAGAC
GGACAGCGGAAGTGAGGATGACGACAGTGATGCCGCCAACGATGTAGGGTTGACTGTGGGCGGTGGCACTCCGCATGCTCACTTAAATGAACGTCAATCC
GACAAACGATCCGCCGAGCACGGAAGAACGACCGAAGCGGAGTTTCGCTCCTCCGAGGAAGCTCGTGGGAAGAAGTCATCGAGACTCACTACAGGTCCAT
CCCATTCGTCCGAGCTTTCTGACGACCACAACCACGACAGCGATTCAGAGAGCAATAACGAGGACAAGGCACGCAAGCAAAAGCACAAGAAGCGCCGCAA
ACACGATCGCTTGAGCGACGACGACCAACACGTCAGGAAAAGGGCCAAGAAAGACAAGAAGCACAAGAAGGAAAAGAAGCACCACCACTCCTCTCGCCAC
TCTCGCAACCGCGATCGCGATCGCAGTCGCAGTGCATCCAGAAGCAAGCGCAAGCATCAGCGACGATAGATAGACAGCGTCTCGTTCGCCATTGCATCGG
GTTGAAGACAATTGAACGAAGCCAAAATATATACACCCTTTGTTGCGGATTTTGCCAGCGCACCGAGTTCGGCAGCGGCTCCGACTCCGACTACCAAGAG
AGCGTCTAAAACTATGTCAGGGATCCGCTAGCTCAAGCGAATACGCACACACGTGTCGGTAAATTAGTCAAAGGTCTTCTTGGAGCCTGCGAAGTTCTGG
ATCGACGTCGACTGGCGCTTGGGAGCGCCGTTGTCGCGGCCGCCNNNNNNNNNNGCCACCGCCGCCGCGGCCACCACCACGGCCACCGAAGCCACGGCCA
CCGCCACGGCCACCGCCATCGAAGCGACCGCCACCACGGCCGCCACGGCCACCACCATCGAAGCGGCCACCACCGCGACCACCACGGCCACCGCCGTTCG
AGAAGTTGTCACGGCTCTTGGCGTACGTGACGCGGATCGCACGACCGTTGACGTACTCGCCCGCGAGCTTGATGGCCTCGTCGACAGCCTCGGTCGTCTC
GAAGTCAATGTGGCCGAAGCCGCGGAACTCGCCCGTCTCACGGTCCGTCGCAAGACGGACGCTCGCGATCTCACCGCACTCGCCGAACGTCGCGCGGATC
GTGTCTTCATCCACATCCCACGACAAGTTGCCGACGAAGATGCCGACGCAGCCCTCCGGCTTCTCCTCGAACTGGTTCTTCTTCTCGGCCGTGCGAATCT
TCATCCACCGGCCGCCAAAGTCCTGGCCGTCCATGGCGAGCGCCGCCTCGGCACCCTCAGCCGTCTCGAACTTGATGAAGGCAGTGCCCGACGAGCGGCC
GTTCTGCATCACAATGTGCGCGTTCGTGATCTCACCGCAGCCGGCAAAGTGCTCCGACAGCTGCTCATCCGTGGCCGACCACGGCAGACCGGCGATAAAG
ATCTCAGTCGTCTGCTGCGGGTTGGCGACAGCCGCACCCTCGCCGTTCTCCTGCTTGTGCACCTTGACGCTGTTGCCAGCCTCGCCCGCGTCCGAGTTCT
TGCGCTTCTTGGATACAATCGCAGGCTGCTCGTCCTCCTCATCCGACGAGTCGTCCGACGAGCTGTCCGACGACGACTCCTTCTTGGCAGCAGCCTTCTT
CGCAGGCGCAGCCTTGGCCTTCGGGGCCTCCTCCTCATCCGACGAGTCGTCCGAAGAGCTGTCAGAGGACTCCTCCTTCTTCGCGGCCACCTTCTTGGCA
GGCGCAGCCTTGGCCTTCGGGGCCTCCTCCTCGTCCGACGAATCATCCGACGAAGAGTCCGACGACTCGGACTTCTTAGCAGCCACCTTCTTGGCAGGAG
CAGCCTTCTTCGGCGCCTCCTCGTCCGACGAGTCGTCCGACGAAGAGTCCGAGGACTCAGCCTTCTTGGCCACCGGCTTCTTGGCAGCGGCAGCCTTGGC
CTTCGGGGCCTCCTCCTCGTCCGAGGACGAGTCAGTCGAAGAGCTGTCCGAGCTGGCGGCGGCCTTCTTCACCGGCGCCTTCTTGGCAGGAGCAGCCTTC
TTGGCCGCGACCGGCTTGGCCGTCTCCTCCTCATCCGACGACGAGTCCGAGTCCGACGACGAGCTCTCGGCCTTCTTGGCCGCGACCTTCTTCGTGGCCA
CGACCTTCTTGGTCACGACCTGCTCGTCGCTGCTCGAGTCCGACGAGCTGTCGCTGCTGGACGCCGGCTTGGCCACCACGGGAGCCTTGACCTTCTTCGC
CATCGTTCAGAGTCGGGGGTACAGTGCGGATCGAGGCGGCGACCGGGATGCGAATGGCAAATGAGCTGCTCGACCGCGAGGACGCTCGATTCGTTGGTCT
TGAGCGGCGCTTTGCGGCAACCGGCGCTCGCGTTTTGGTTGGCTGACGAGATGCCGAGAGCTTGGCGCGACCTTCGCGTCACTGTCCGATGTGGTGGCCC
ACACCAGTCAATGTGGGCCGCGCCACATGTGCGGCGGTCCAAAGTCTGGAGGTTGGCGGATTGAAAAACCTCGGTTTTTGAAAATGCGATCGGTTTTTGG
TTCCACCAAATGGTTCCGAACGGAGGTTTTTTCGCCTGCAACCACATAGACAAACGATGGAACCGCCATCGCGAGGTTTTTATCTCCTTTTCAGCGGTGC
GCGTGTGGTGTGGCAGACAAAATCCATTTCGATTCCGACGCGACCCAGACCTCGGCAGCGTTTCCGCCATGGTGACCGCGATCCCAAGCGCCGAGCCCGC
GGCCAGCGCGAGCGACGTCAAATCGCCCACGGGCGACGCGCTTAGCCGGAAGCGCGCCCGCGACCCTGCTCAACCCGAGGCGGCGGCGGCGGCAGCGGCG
GATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGGACGTGGCGGTTGAGGAGGAGGACGGCTTCACTGAGGACGAGAACGAGGCGATGAGCGAGGTG
ATCGCCAAGATGAAAGAGGTGGCCGACAGCACGCCGGTGGCGTTCCCTACCGCGGCGGGCTCTGCAGTCGAGCGCTCGTCGTCGCCGTCGTCCAAGATCC
CTGCGACCTTGGCAGTGACGAGCGGGACTCCGACGGGAGCGGACGTGGCTGGCGCCGCGCGCGTGCAGCTGTACGACAGCAAGCGCATGTCGCGCGTGTC
ATTCAACTCGTGGTTCGAGTTCGACACGTACTTCGAGATGTACATGCAGGACACGTTCCAGCCGTTCCGCATGCGCTCGTCGTGCAGCGTCGAGGCGTAC
CGGCGCAACCAGCAGAAGGTCATGATGAACAACAAGAACTCTCGCGGCCGCCGGATCGAGTTCCCGGACGAGGCCATCCACCACCACCGGATATACATGT
GCACGCACGCTATGAAGGCGCGCTGCCGCGGCGCCACGACCCGACCGGGCCAAAAGTACCGCGGGATCGGTTGCATCGCCAAGATCAACGTCAAGATCAG
CCCGTCGGACAACCCGTCCAAGTACATGGTGATCGTCACGGACCAGGTACTACTAGCCGATTTCGATCATGAATACGGCTCCATCGATCACTGACACTTA
TGCTGCTCGTGAATGCACAGGTGGTGACGCACAACCACCCTATCAGCCGCGAGATCTACGAGTCGTACCCGGACGTGTTGATGAAGACGATGCGGCGCAA
CCAGCTGAACGCGTCGCTGCTGACGCGACAGCCTGTGCCCAAGTTCGAGACGCCCGCGCAGTCGCAAAAGTACGAGCGCGCGGTGAACGTGCTTAACTCG
GTGGCGGAGGCCATGGCGCGGCTCGGTGACGACGACTACGAGGCGCAGTTCGCGCAGCTGCAGAAGATCTACACGAGCTCGGTGGCCGGCCAGACGACGC
GCACGGTCTGAGGCTTGAACGGCGATGATCGAGTCCAACCGCTGTATGAGTACGAGACGGGCTGGCACGCCATTCACAAGGTCGCACTTGGAGTCGCTCG
CCGCTGGCGGTGCGGCCCGTGCAGAGCATTTGCAATTCATGCATGCGTGTATTTTTTCATCCCGCATTCGCTCTCCAGTTGACGGCATTGCAATTTATGG
AATGTGGTTGCATAATTGCTTTGCACCTCCATTCATTCGAAATATTTCGTAAAGCATACTCACTAATTGATTCCGAATTGAAGCGAAGAAAACCGGCCCG
CCGGTGACGCGGCNNNNNNNNNNGGCCGGTCGGGCGGAAGTTCCGGTCGCCTGCGGACTCGCTTTTCCCCTTCCCTCTGCGCGCGGGCGGAGCCATGGCG
GAGCACGGCGGCGTGGACGTGTCGATCGCGCCCAACTCGAGCGTGACGCTCGAGCCGGCGGACTCGCTCGCCTTCCACCTGGNNNNNNNNNNCGCCGCAG
ACAGCGCCGCAGGCAGTGCTCACGATCCGCAACGTGTCGGACGAGCGCAAGATCGCGTTCAAGGTCAAGACGACGCGGCCGCTGAGGTACCTGGTTCGCC
CGAACCAGGGGCTGCTGGCGCCCAACGGGTCCGCGAGCGTCATGGTGATCCTGCAGCAGAAGGACGGCGACGAGCTGCTGCGGCTGGACCCATCGGAGCG
CCAGCTCTCGAATGACAAGTTCCTCGTACAGAGCCTGTTCGTGGACGACGCCTTCTACGAGCTCGTCAAGACCAAGTCGGCGAAGGAGATGGCCGACGAG
CTCACCAACATGTGGGCTCACACTGACAAGAAGGCGCTGTCCAACAAGAAGCTGCGCTGCCGTTTCCTGCAGCAGGACGAGGCGAGCGCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCGAGCCGTCTCCGGCCATGTTGCGGTACCAGAACAGACAGGCGAGCCAGTTCAGCAGCGCGAGCGACCTGGCGAT
TCACGCGAGTGAGTCGAGCAGCGCCGACACGGAGGTAACCACTGCCGCACAGCTCTCGTCAGCGCTGCTGCAGGAGAGTGCGAGCCCCGACAAGCCTGCA
AACCACAAGGCAAGTGACGGCAGCACCATTAAGGTGACCGAGGGGCGACGGTGGGCATTGCTGGTAACTCGACGGCTCATGTTGTGGCGTGTACCTCGTT
CTTCCAGGACCCGATTGCCGACGTGGCTGCTCTGCGCAAGAAGTACGACGAGGTCAGTTCGAGGTGGAGTGTACCGACCGAGAGTGCGAACAGGGAGGAC
TGACTGTGGTGACTGTGTGACTGTAGCTGGTGGCGTTCACTGTCCAGCTGACGGCGCAGCGCGACGTGCTCATGAGCGATCTGGACAAAACATATCCTTT
CTCAACTCCCTGCTGCTCTGACCTATTTACTGGATGACTGTCTTTCCAAACTGCTTTGCATGCTTCCTTGACCGAGACTTGTGACCGATTGTGCACTCGG
CAGCTGCTGCAGAAGGCGACAACGGACGCGCAGCGCGCACGCAAGCTCGCGGACGACGCGGCGACGACGGGTCTTCGCCAGCGGAAACCCGGCACGACCA
ACGGCACCAGCGACGATGTGGCGTCTCCGCGCGGAGGTGTGGTGACCAAGGGCGGCAAGGACCAAGGGGTACGTCGCTTTGGAGCTGCGCTGGTCGATGC
AAGCAAGCTCGCTTTGATATTGATCCTTGTGCTGCTGTTGTGCTGCCAGACGTTCGGGCTGCTTCATTTGATCGTGTGCGCAATCATCTTCTTCGTGGTC
GGGCGCTACTACTGAGAGCCCTCGCCTGTATTAGATGGGGCGTCGAGCGGCAAACTTCATGCTGGCATTTCAAACCTGTGCGTCAATAGCCCATCAGTCA
CGGAACCTTCGAGCAGGACGCCTACAAGGGTGGGATGGAGTAGGTAGGCTCTTGAGTTCCAACAACGATTCGGATGGATGCACAGCAGCCGTTGCTACCT
TGACCGCGCCGTTTGTCTCCGTCAGGCGTCCAGGCTTCACCAGATCGTTTATTCCCTTTCGATATATCCTTCTTCCTCTGTGCGCCACCAATCTAAGCTT
CGACCGTCCTACAGGAGAGCCACATTGATCTCTTCAGCTACTATTGTGCATCGCCTCCGGCCCCCATCTCTCAGTTGAGGATGGCGGTGACGCTCATCTT
GCGCTTGTTCATATCGCCCTGGAGCGCAGCGCAGGCCTTGCGCTTATAGCCGCGGGTTCCGTCCGAGCCGCTGTCAGCGCCGTCCGACAACTGCATCTTG
CCAGCCAAGCTCTCCTTCATGGAAAGCATCGCCATGGCAGCAGCATCGCTGTCCGAGTGAGTCTCCAAGCGCACCGAAGATTTCGCGGTCGGTGCTGGCA
ACGGCGGCAGTCCATGCGGTTTGCTGCTCTTGCCGTCCGGGACGTGTCCGCCAAATCGCTCGGCTACTGCCTGATCGTCGCCCGCATATATGAACCTGGA
CTCGTCGTCCCCCGCGTCGTTCTCCTCGTTCTCCTCGTCACCATCGTAGTCGCTCACGCTCTCCAATTTCTTGAGCTCGCGAACATTGCTTCGAAGAGCG
TGAACACGCACGAGCGTCACAGAGTCGTCCGACCGGGGCGACAAATCTGGAGGGATCTGCTGGCTGGGTGAACGCTGGTAGCTGTCGCTGCTGTCGACAT
TCCCTCCACCACCTCCGCTCCCACTGCCTTTCGCGGCCGGTGGCGTGTGGGACGGATTGTGCTGCGGGTTCCCTGACGGGTCCGTTCCAGTCGAGTGTCG
GCGATTGTTGGACGACGAACTGCTGCCTCCGCCGCCACGACGCGACGAATTGTTGCGTTCGTCGTGCTGCTCAATCGTCGACCCCGTCGTCTGCATGAAG
ATCTGCTCGAGACGGTCGATCATGCGCAGCAGCGGCTCGTACGTGGCAAACGGCTGCTTCATCAGAATCGTGTGCATGAACTTGCTTCGAGTCGCGTAGC
CTGTCCACTTGTCGTGCTTCTTGAGGATCTGTCCCCGCAATACTGAAGTGAGCTACGATGCAACCACGACACATCGCCCACAATACGTTCGACGCACCTT
GGAGATGCCGCAAAAGTTCATCACGGCAAAGTTCTCAAGCAACAGCAGCTCCTTGTACAACGAGATGCAGCCCTTCATGAGCTCCGTCTTGTCGTCGTCC
TTCGGCGCAGCGCTCGTCTGCGAAACAGAAATTGCAGACACCCCGAAACGATTAGCTTTGTGGCATCGATCAGCGAAAAAAAGATGCGCGTGCAAGCTGC
ACTGCCCAGTTCGCCCTGGCCACCAGTGGCACCATCAACACTTTTTGGTGCGTCAAGCTGAGAGATTCAGCACCATCTCAGGGTACGTTGACATCACCAA
AAAGGGGGGGCTCAAGGGTATCCACACACACGCGCGCGCATCTCAAGCTACCAGCACTCACCTTGAGCTTGGCGAAGCTCTCCTCGATCGACGTGATTCG
CGCCGTGTGCTTGTTCTGCTCCTTGATGAAAAACGTCGCGATCTTGCGGATCTCATCGCGTAGCGTGCGGAAGAAATTGGTCTCGTCCTCCGAGTTGCCT
GTGACACGCGCACATCAACCCGCCCTGTCGTTAGCGAATCGACCGATCAACGCCTGCCGCGATTCAAGCGGAAACACGCACGGATGCTATCGTTGTCCTC
CTTGGCGGTCGGCTTGACCTTCGTGCGCAGCTTCTCCTCCTTGTCGATCTGCGCGCAGTCCTTGATGATCTTCTTGAGCAGCTTGTAGTCGACCCAGTAC
GCCTCCCACCCGTGCGGCGAGAGCTGCATCGACTGCTGCAGCACCTTGCCGAACTTCATCGTCGCTCGCC