Description :
From Genome Similarity Track
Location :
scaffold_308:6391- 8001
Transcript NameFunction/comments
g7101.t1 hypothetical protein PHYSODRAFT_325210
g7102.t1 hypothetical protein PHYSODRAFT_523009

Sequence
1610 bases(100 bases per row)
CCTGAGCGTGCGATGCTGGAGGTCCTGTAGCCACTAGAGCTCTCTCACCCTTGGTTGCGGAGGTCTCAGGTGTGCCCTTGGCCAAGGAAAGCGCTCTTGA
GCTTGGAGGTCGCGAACCTTGCCTTCAATGCTCTGCTTGAGGTCTTCATACGGGATGTACTTCCGCTGGCCCTTCCAGATGCGGAGATCGTCCTTCCACG
ACTTGGGAATCGAATGAAACAGGTAGATAGACTTCTGTCCCTCGGTCATCACCGACTCAGTGGCTTCTGACGCGGCTTTCATCGCATTCTCAAGTTTGAG
AAAGAATTCGGTCAAGTCAGAGCCTTCTTCATACTTGATCTCCATCAAGTAGTGTAGGATGAAGTACGGATCACCGTGACAACTTTCAAGCTCTAATCAA
CCTCACTTCGTCTTTTGACGGTTACCACGAACATCTCTCCTCTCTTCTCCTTCTTCACTACCCAGTTAACCTCATCATAGGTTATGAGCCCAAGCCAAGT
CTCAAGCGACGACTTCCCCTGCCTCGTTGGCGCTGAGAACTTCGACGTGTCGAAGACTCGCGTGTGCGCAGCACTCGATGGCAAGCACCTACTCGGCTAC
GTGAAGCAGCTAGACTACGATGGTGTGTCTGAAGATGAGAGTGAAGCCAGCGCAAGCGACATGTCCGACATCGACGACGAACCACCGACCAAGGCCACCA
AGGACGCCGAAGTCGACTCTGACGCTGTGGACTACGAGGACAGCGACGATGAGCTCAAGCCGCCCTCAGACTCGGACGAAGATTCGGGAGCCAGCTCTGA
TGCATCGATCAAGCGCAAGGACCTCCCAGTTGTTCGACCGTTCAACTCGCGTGAAGCTCGCCGGGCACGCACGCGCGCCAAGAAAGAGAAGCCTCAGCCT
CTTAGCCAGCGTGAGCGCCGTCGCCAAGAAGCCAAGACCAAGGCCTTCTTGATGAAAACGATGGACAACATGCACGTGCGGCTGGTCAAGAATCTCACGA
CATCCTACGAGATATTCAACTACATCTGCCAGAAGTACGAGGGAGCAGCCTTTCTAGCTACACCACCAGTCATTACAGGACTGGTGTCCACTATAAGTAT
AGTCAGTACATGCTATAACGAGTTAGGGAGGCCCTGTCACATCTACTTATAAAGTCTAAGCGAGTTTATCATGACCGTAAACATCATGTTTGGAGGCCAC
TTCAACAACATGGATACCGTGCTTTGGTGTCAACATGTCCGAAAAGCTCTTTACTCGTTCATATTTCGGAGTGTACCGTTCCTAAAGCAGGTAACAAATA
CTTCGAAGTACTAGTACATGTATAAGGATTGCCCATTTAACCGCACGATCAAAGCCAACAAAGGCTTCTGACAAAGCCACGTAAGGAGCTTCGCGCGCCT
GGAAGATTTAACTCACGCTGCATATTGTTGAAATATTGAATGCATACAAGTATAACCTTTTGACAACTGTGCCAATAGTCCCGGGCCGGATAAAGTGTGT
CAATGGCCGGAAATTCCGGCCATTCATACACTTTATCCAATTGGAGCTGCTCCTTTGCCGTAGTTGCCTCGGTCTTCTTCACTACCTGTACGAGAGTTGC
CCTTGCTAAA