Description :
From Genome Similarity Track
Location :
Scaffold_1219:639- 4832
Sequence
4193 bases(100 bases per row)
AGAAGGGATGACGGTCGAAGGAGAGTCGCGGTGCCTGGATCCAAGGGTGGATCAGACAAAGACCGAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGAT
CTACACGCCGAGGATCTTGGAGAAGGTATGGCGGTAATCCCGGAGGTACCACTGACCACCGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGG
CGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGCCATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCCGCCGCCCGCGG
AGTCAAATGTGACATCAATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCATTTCCGAGAAAAACTGTCAGATCTGATTAAG
GGCCTGCTGCAAGCCAGGATCATCAGCTTCTCAACGTCCCCGTGGGCGTCGCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCA
TTGATTACCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTGATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTA
TTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACC
CGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTCATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAGTCCGAAACAGGTG
GGTCTGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGAGACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGA
CATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACGTCCTTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAG
AGCTATTGGGGGATGCGCAAGGTGGAGTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGATCTGTCTTCATTAGCCGTTTTGT
CCTTCCCACAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTA
CGAATTGAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGAT
CCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGA
ACATGGAAAAGGCAGAATCTCGGTGGTTCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCC
GAAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCATCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTC
AGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTCAATTACAACCTGCTGGTGG
GAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTC
GCCTTAGACACTGGAGATTGTAAAATGTTCGAAAGGGGAAGACGAGGTCCTGGGAGTCTTGGCCGCGAGCATCACACCTAGAGCTAAGATGGATGAAGCG
CTGGCTACGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAAGTGGGTGAGGATCTGTACGTCCTGAGTTTCGATG
GATCCGCTCGCGTACGACGCGGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAGGG
CCTCACCGTCAATGAAGCAGAGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGGGACATGATACACAAAGGCTGGTGATTTGTGGGGATTCAAAC
CTTGGTGATTCGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACCGCAGAAAGTGATGGTTCACCTGCGTGGGTGGATGAAT
CACGAGTTTGGTGCATGTTCAAGCGAGATTGGGAATGCCAGTGCAGATAGCTCTGGCCAGTGCCGCTTTACCGAAATCTATGTGGTGTCGAAGTGGAGAG
AGAGGCCGAGCATCATGATCTCGTTACGTTGAACCGACTAGACGAAGTGTGGTGGTTTGGATCCGTAAAAAAGACAGTCCAGGTAATGGCTGTCACTAGG
ACCAGAGAAGGATTGGATCCAGCCCCCAGATTCTCGATGAAACATTTGTGAAGGGAGTCCGCATTGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTG
GATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATTCCAAATCCTACAGTATGGTTGCTACGGATTATGCAGTGGAT
CTGAATGACTTGCTCTTCTATTGTCCTCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATG
TCCTACATCACTACCACGCTAGTTTAGAAGGTGGACATCAGGGAATTGGTCGGACCTACCAACGGATCCGAGAATGTTTCCACTGGAGGGGACTATCTAA
GAGCGTGCAACGGTGTGGCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACGATCGAAGGGGAGTCGCCTGGGAATGTCCAAGCGACTTAC
CCTTTCCAAATCATAGCCATGGATCACATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATCTGGGTGGATCTGTTTACCGGATACG
TGATAGCCAAAGCTAGTGCGTCTGGAACTGCACAAACCATTGCCGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGGGCTAGTGAGATGATTAGGCA
CAATCGGGAGCCAGGCTTTATGTCTGATTTCTTCTGATTTCTTTCGAGCTTTTAACCGGATCCTGGGGCAGAGACAGCGGCAACCATGGCATATCGCCCC
CAAGCTAACGGATCGGCCGAGCGCATGGTACAGACGATCACGAGGGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAG
AACGACTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGACACCCCATTTTACTTGGTACATGGGTGGGATCCTAAATCCACCCTAGAAGC
GGCCATTCCGGTATGTAGCATTAAGAAGAGAAACCGAGATCCAAGACAATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAAC
GAACGGCTGCGGAGTGCGATACAAGATCGAGCAGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTAG
ATCGGGTGAAGGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCACGGACCGTTCCGGGTGAGCGAAAAGATAGGGGAACATGCGGTGAAGTTGGAAAC
GGCAGGTACCGAATATCGCTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAGGAATATCCGGACCGGCCGCAAACCCGTCTTTCGGTGGAT
GAATCCAACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGGATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATA
TGAGGTCAGGGAAGCGAACTAGATACGGACGGATTTACCGCGAATTTCTGGTGTACTGGAGTGGATATGGCGAACCCAGCTGGGTAGCCGAGACAGATCT
GAACTGTGGAGCATTACTCTATGATTTCTTGCGGGATCGTACGAATCGGAACAGATTCGGCGTGATGCGGTCTCATGAAGGCGAGTAGGAAGG