Description :
From Genome Similarity Track
Location :
Scaffold_1143:639- 4625
Transcript NameFunction/comments
Phyag_g9658hypothetical protein PHYSODRAFT_511111

Sequence
3986 bases(100 bases per row)
CGCACGATACGTACACGCTGTGATGCTGCCGGAATTGTGTACACTCGCTCGAAATGGAAGCTGTATTGGGGGTACTTTCGGAAAACTTGGCTCGAGCGGT
ACAATATCGATGCCTGGAATGTTCATGGACTCAACAATAGACTTGTCGCCGGGACAAATAACCCTCTCGAACGGTTCCATCGTGAGTTGAACCGTTCATT
TCCAACCCCGCATCCCAGTATTGCTACGTTCGTGGAGACCATCCGGACAATTTCCCAAGATTTCGTCACGAAGCTGACGAACGTtgctcaaggacgacgc
AAGCGAGGCAACAAGCGCAATGCTAACAAGCGAAAGGGGTCGGAGCGTATCGAACTCCCTGCACCTGTGCATTTCACAGAGTCGGATGCGGTTACCGACT
CCGAGAGCGAAGAGGAAATGGTTGCGAGTGAcacttcttcagctgatGAAATGGATAGTACCGAAGAAAGCAGTGCTGAGGAGGATCTACCAGACTATTC
GTACGAGCCCGGTGAGTATTGCGAccatgctggaggtgatcgCGAAGCGTTGGTGTAGCGACTACTGTTGGCAGCGCACCTTGTGACCAGAATTTAGTGC
TAATACAGCATTACTTTTGTGGTAGGGACTAGAAGTAGTGAGCGCTACGGGCGCGACGAACTAGGGACTCCCTGATAAGTAATTACATCCTGGCTTTTGT
GTGTCATCGATGCGTTCACGGAGCGCATTTGTTTGGCAACCTCATAACTTGATGTCTAACATGCATTAGCAAATTACTACGGGTCGGGCCTGATGTTGGG
TCGGCAAAATTGTACGACCCAAACAGGCGATCCGACCGGTACACGACCCAGGAGAAAGTCTACCGAACAGCGATCGTAATTCACGCCTCGCAAAGCTCAA
GAGCTTTCAAGTTGGCCGTGCCTACAGCATTAAACACGAGCGTTGTGCAACGTGCACCAGCTTTTTGCTTTCTTCCGCTATTTTCAGCACTACACTGTCC
TTCAGACGAGGTTCTCTTGTTGCGACTTGATGGCGGTCGATCAAGTGACGTCGAGCGGTTTTGATGCGCAGCCATCGACGTTGGCCGAGAAGAGGATCTC
GTCGTCTAGTAGGCATGCGATGAAAACGATGCAGGAAGGGCCCGAATCTGTTGGGTCGAAGCTCAccaagacgaggaagaagaagaagaagactaACCGC
CATCAGAAAGAAGACGCGACTCGTCAATTGACGAGTTTGTTGCGGATCGAGAGCGACAAACTGAACGAACAGCTACTGATCGCGAGCGAAAAGGGCAAGC
AACGCGCAGTCTTCCTGTTGTTGCACCAAGGAGTCGACAAGGACCGATGCCGGGGACTCGTAAGTGTCGAATTTGATGGGGTAGACAATGATATCTCTAA
GTATGGTTGAttccgttgctgttgcagcttgggTACTCTCCGATGCATCACGCAGCGGCTCGAGGACATTTGAATGTGCTCCAATTGCTGCTCGACTTCG
GATGGGGTGTTGATGTCCGTAACGATGCTCTTGAAACCCCCCTCCACCTCGCCTGCTTCGACGGTCTTGTCCACGTTGCGGAGTTCTTGCTGGATCGCGG
TGCAGATATCAACGCGTGTACTGATGACCAAGAAACCCCGTTGTTCTACGCTGCACGAAAGGGTCAGTACCGAACAGTGCGTCTACTGGTTCGTCGGGAG
TGTGACGCTGCTGTAAAGAATTGCTACGGAGacgttgctgaagaagaagctcgagacgccaagacgctggctGAGTTTGCGACTGCAACTGAAGACTTGC
AACGAGCGTCGGCTGCAGATACTCAACGAGGGACAAGTTCCGAATGCGGAGAGCACGTTTTATCGCAACGACTACGTGAAAGAGTGCTGACGTTCTTGGA
CCTGAAAAGTTTGGGATACGCTTCGCAAGTGTCGTATCGGTGGCATCGAGCGGCGGATAATTCGTCGTTGTGGAAGAAACTCGGCGTCTCTCGATGGGGG
CTGCTACTCAATGCAACGATGGGAATGGGGACGGTGTCTCCGATGGCGATGATGGGGACTGCTACCAACAAACTGTTCCGCCTAAATCTTTCGTCGACAG
TGAATCGACGACCATCTAGCTGTGATCAAGTCAGTCTCGCTAGACCGATGCCATTAAGTGCGAAGGTAAGAGAACATCCGCGGCATCGAACAGAGTTACG
ACCGCGTACAGCAAACGTTGCAGGAATATAGATTGCCTGCGTTCACGTACAACTGAGAAAACGAGTTTTACCCCCAACGATTCAAAGCCTCTATCGAGTA
TACGTCGTCCACCAAGTAACTTCCGTCTGAATAGGACTCGACGGTTGCCAAGATGGTGCTGCCAGTTACCACAGACAAGAGCGTGGACTTCCCAACACAA
CTCAGCCGGTTCACTATGGCCGACTCGAGCGACAAAGGTTTTGGCAAGTCAACCGACTGGGGAGCAGAGTACTACAACCAAGAACGACttcgacgcagca
gtcgagAATGGAAAACTCTGTTCCAGCCGTCCGTCATCGGCGCGTTCTTAGCCATCGCAGGGCGTGTCGTCGTGGCGCCGATCGTGATGATTCTGCTCTT
CACCGGCACGAAATACCTTTCGGACGCCACCGTGCTCATCAAGTCcgccaacagcttcttcgccttcacaGAGCATGATCTGTCAATGGCCGGAGGGTGT
ACAGACTGTATGGGTGCATGCAAAATCGTCTTGCTCAAGTACGTAGCATTCGACGGGCAAGCGCTCACGAGTGCACCAGCATTTACAGCTTTTGCCGGTC
AGGCGGCATCGGGAACCGTGTACGACTTCAGCCCGTTGAGTGATGCCGCTATTGCACTTGGGAAAGCACTGGACGATGGCGGTGCGATCTGTCAAAGCGG
TCGCAATGAATGGGGCTCCACCACGAACGTGGTCACTACGACCCCGCAACTAATGATGGacgtcatcaccaccatgaaCCTCAGTCTCCCACCGCAacag
atgaaggagctcgaaTTGGGCATCGAGCATGCCAACGAGTGCGTGACAACGTGGAGTATGATGGGAACGGCTcgactcttcttcttcccaaCGACACTCG
GCAGCGCCGACTTCGGCAAGATCCCcgctgtggtggtgaacaTTGGCCCCGACTACACAGAATGCCGGCCTAATGTCGCGGTGGATAATACTGCGGCCGG
CTCCAAGTTGGCGCTAAATACTGGAGGGAAGAACCTCCTTAGTGTTGTACCAGAAGTCTTGACATTGTTCCCCTACAGCTTCACAAGCAGTTTGGCCACA
CTCAAGCGCGTGGTTGCAGCTGGTGATACGCACTATAAAGCTGAAACTGTAGTGGAACCTCTGCTACAGGCGTATTATGGAGGCTGCCGAGTACGTGAAG
TAAATACTACCGGTGTGTACATTGAAGCGGGTTGCGATACGTCGGCACACTGGGAAATCTACGGCTCGATGGTGCAATCTCCTGACGACGTGCCGCTGTG
CAGTACAGGAGACGTCTGCATCCACAACTACTTCAACACGCAGTGGGAATGGGTGAGTGAGATCACAGCCGCGAAGCCGAATCGAGTTGCCATGTTCCTG
AACACTTTCCGAAGTCGGTACGCTGATACGGTCGAAATCAGCGTTCTACCTGGTGTGGTCGTCGTCCAGATGCTCGTAATGGGGATCGTCGGTCTCTACC
AAGCGATGTCGCACAAGCGTTCGGTACTGTTGACTCAAATCTGGGCGTATCGATGCCAGAATGGACGAATGCAGGTCGTCTACCTTGCGCAGATCACTTA
CCACCTCGTGTACAATTCGGACTTGTACTTGCTAGGTTTTGCAACTGGTACATTGACGACCGAATCGCTCGCGAATCTCACatgctgcttcttcgcgttc
tCGTACTCATTTGTCAACTTGGCCAAGGCGCGTTCAGGGGATCAGCAGCTTGATCGCCAATTCCGATTGACTTGGGAGGCCATGCA