Description :
From Genome Similarity Track
Location :
Scaffold_41:639- 3444
Transcript NameFunction/comments
g12572.t1hypothetical protein
g12573.t1hypothetical protein

Sequence
2805 bases(100 bases per row)
ACGCCGCCGACGAGAAGGTTGCAGATTCAAACGCCGCGGACCGTTTCCATCCTCGATGCTGGCTTCATCGTCGTCGGCATCTCCGTCATAATCGCCGTCT
TCATCGACTGCACCATCCCCGTCGTCGGCCTCGCGTCTGTCTGCACTCTCATCTTGGGGATTGCCACTGGGCTGGACAAAGGAGATCAGCCCTGCCACAC
GTTGGCGGATGGCATCACACTCACGGACAGCTCGATCACGCGAATCAATCAGTGCCGCGCGATCAGCACGGGAAGCGGTCAAATCTCCAGCCAGGGTGAC
ATTCTCCCGCTGTAAAACTTGCACGCGATTGCGATCGCCCTGGAGGCGAGTCACTTCACCTTCCAAGCGAGCGATGGCAGCCCTCAGAGAAGCCACAGTG
GAACCTGGAAAAGAACGAAACGACATACAGTTAGCACGGAAGTTGACATAGGCAGGCAACGCATACGTACGGGAGGACAACAGCAAAGTCGCGGCCTGGT
CGCGTTCGGTGATCGTCCGTTGGAGTTGATCTCTGACCGCTTGGAGCTGAGTGGAGGCGTCGGAGGCCTGACGGCGAAACTGGTCGCGTTCAGTGTTACT
ACGCGCCACATGGCGATGCGTGGCCGAAAGTTGGCGGTCCATGTCGCGTTGAAGGTCACCAAGGCGGTCTTCGAGGCTCTTGACTTGGGTCTCATAGTCT
CGTACGCTCGTCTCGAGTTGGCGGCGAGTCGACTCGGATGTTTGCAGATCGCCACGGGAACGCTGTAGGTCAGCAAGCACCCGATCGCGACACGCACCCA
ACTCCACCAAGTTTCGCTGCTGGACCACTATGTGACGGCTGAGACGAGAAGATCGATTTGATCGCGCTCGGGGCGATGGAGCGTTGACCCGCGCCTGCAG
ATCGGAGACCTGTCGCTCGAGAGCACCGATCCGGTCGTGGAGGAATACCACATCCTCGTCGTGCGATCGACGTTCTGCGGCGAGTAACGTGCGAGCCGTG
TCGAGAGCGCGGCTGTTGTCGAGTCGGTTTGCCAGGGCATTGTGAGCGTCAGCTAACGCGAGACGCGTACCCTGATGATCGCGAAACAGCGCCGAATACT
GCTCCTGAGCAGATTGCACGAAGGTCGTCGACGACGAGTACACACGATCCAGCTCTTGCTCTAGTTCGTGGGCTCGGGCCTGCAGGGCGACGTGATCTTG
CGCCAAATCGGCGTATATTCCTTGGACCGCATCTTGATCGCTCAGGTGGCCGAGTATCCGGTCCAATGTGGCGCGCGACGCCTGCAGTGTGTCGCGATCC
GCTTGGGACAACGTGGTGATCGACATCGGGACGGGGGCGGTTGTCGGAGCTTGCGCAGCCGGTGTAATACCGGCTGGAGGCGATGCAGCATATGCACTGA
GCCCACGCAGCGTGCCATGGCGCAATGCCTGGGGGATAGCGCGCGTAATGTCTGGGACGACGGGAGGCAACGCCGGTTCGGCGTCGATTACATCAGGAGA
AGCAGTGCTTGAAGCGGATGAAGGCGAAGGGGTTGCCGACGATCGGTCGCTGGATGGCATGGCGGAGGCAGATGGCAGATGGCCGTGAACGGCGCACGAC
CAGACCCGGTCGGAGGAGTAGGTGCACTGCGGCAAGTTGGAGACTGTGGCGAGAGTTGAGTGCTGTACAATCGCCTCTCGCACAGGGGGCGGTTGTGGAG
AAGTGACCAGAAGTTTTGGGAGATGGATTGATCGTGTCCGACCAGGTGATTGGTTGATGGGCTCGGATGGATGGCTTTGGACCTGGGATGGGCGGCATCA
ACGGTCGGACGACCGGATGGTGAATGTGAAGACCATCATTCCGATCTTGGCAGATTTGGTCGCGGTACCACATGTTGGGTACATGAGTTCAGATCAACCG
ATCGGATCAACATGGGTTCCGATCGACCGATCAGATTGACATGGGTACAAATCAGCCGATCAGATCAGCACGTACCACAAATACCGGCACATCGGAGGTC
CAAGAATGTCAGCAATCATGAGATACGCAAGCGAGATGGGGGATAGGCACGTAGTTCTTAATGGATAAACAGAGAGAGATTTTCCTTGTAGTACGCAAGT
GGTCTTCCGAATTCCGGGGAAGGAAGTATATTGGCCTACCCGACGACCGGACAACCACCTGAAGTGACTCAAGCGAGAACGCGGAAGCCCCTGGATAGCT
TGGCCAGGTGCGCTCCCCTTCTCTCTCCAACTCATCAAGACCCCGCCATAGGAGGCGGCAAGCATCGAAAAGGACCCGTAAAGGACACACCCCGTGATCG
ATCACACACGATCGTCACCCAAACCGACTGCTGCGTGAAGCATATCCGCGTGGCAGCCAACCACCCCCCATACCTGAAGGGCCCTCAAGCCCCAGTTCTG
CCCTGCTCACCACTGACTTTCCTCGCGTGATTACCGGAAGAGCGTAACCCGCCCAAGCCGTCGGGTACACAAGGTGAGCTGTAAGGTCAAGATCCGCCGG
ATCAACGGAGTACCCCCTCCGACAGTCGGCAGTCCGGGCAACCGCTGGTGAGTTGCGATCGCGTCAGCAATTTCGTGATCCCGCTCCACCACATAAACTT
GAACGACTGCACCATGGTGCAGTCGGTATTGGACTTCCTTGCGCAGTGCCTTATGACACTGCTTGTGAGTACTGCTACCCCGGAGCAGTACGCATTATCG
AGCGGGACGTCAACGGGTACACGTCCATGTGTGTACCTGACGACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAGGCGTCTTCTAGTGCTGCGGATAT
TCGCA