Description :
From Genome Similarity Track
Location :
scaffold_250:639- 25006
Transcript NameFunction/comments
g6304.t1hypothetical protein
g6305.t1hypothetical protein
g6306.t1hypothetical protein
g6307.t1 proline synthetase co-transcribed bacterial protein
g6308.t1hypothetical protein
g6309.t1 conserved hypothetical protein
g6310.t1 conserved hypothetical protein
g6311.t1 60S ribosomal protein L21-1
g6312.t1 pre-mRNA polyadenylation factor, putative

Sequence
24367 bases(100 bases per row)
TTCCCGTAGGACTTCTTAAACTCCATTATGAATCGAAACCATCACGATGTCGACACGCCAAGATCGTCCCGCGACGACGGCCCTGTCTTCGTGGGTCTTC
GCTGCAGTGAGGACACGCTAGCGGTCAGCGTCTGAGTAGCGCTGGTATGTCATAGGCAAGGCAAAATGAAGAGTGAAACGGTTGTCAATGGTTGCCATGA
CGAATGGTTGGTACTCATCGCACTTCGGTAATTGCTTCCCGCGCTTGGAAGACTCGTCAAATAGATAAGACTGATTCATATCAAATTTAGCGGGGATTTG
CAATTTGATCGGAGAGTTTTGCAATTTGCTCGTCAGTTTTTGCAATTTGATCATGAAATGGTGTACTTGTAGTGCATGTACTTCTTTGCGTGGATAAAAG
AAGAAATGTGCCGTGTTGCTCGTTGGACACCCTGTGAAGTGGATACAGCTTTTTGCTACAGTGTTCAGTGAACACCTTCGAGTAAGTACTTTCCTTGATT
CGCCATGCTCTTATTGACGAGCTCTATTGTCAATTCTGGCCAAATTTTCCAAACTCGCTATGTTTGTCGAGCCCCTCAATACAATTTTCAAGATGTTTGG
GAATCGACCAATCACCAAAATAAGAATTCAGTTAAGTACGCCTCCGCACTTTATCGAACCAGATAGTGAATTCAAGTGAATTGAAACCCAGGGCCGGTTT
GAAGGCCGGTCGGTTTACCAACCGCTCTCGGAAATTTCGACTAGAACGCACAATTCGCAGTTCGTAAGAACTGTTCGTAGTTCGAAGAACTATCGTAGGG
TAGTGGGGCGCGTTTGTGATCGTACGACCTTCGGGCAACCTTGTCATTCGAGCAACCTCATGGAGATGAATCTGAAGAGAAGGGAGAAGGAGAGATTCAA
CCTCGGTATCGATCAGAAGAAAGAACAGGATCACCTCGATATCGATAGAAGATGAATCGGAAGGGAGAACGGGATCGGAAGGAGAAGGGGAGATAGCTTC
CCGACGAGGGGAAGGTGCGCTGGAAGAGATAACTTTGAAGTAGCAAGGGAACAAGCACTGGAGTGGTTGGCGATGGTAGATATAATGGAATGCCGTGACA
GCAATGTAGTCGGTGTGAGGACATCTCGGTCGAGCAGGCCATCAAGTACGTGACCGACTTCAAGAATGTCATATCGGCCAGCGACATCAGCGTGCCCGTC
GGTATCACGGTCATCGACACGTTCGTCCAGTACCAGGGCATACTCATGCCTGACCATCAACCAGCCCCTTTTGGGAGAAAGTTGATGCTGACAAGCCCAC
GACTCAGTTTAACAAGCGCATCCAACCGCTGCTCAGACAGCCAGCGACATGGAAGTCATCATCAGCGAGACTGGCCGGCGTCAAGGGCGCCATGCAATTC
TCGTCTGGTGCTCCGTTCCACGGCCGCGTAGCTCAACCTCTTTGAGAGGCGCGTGCTCATTGGCATCTACAAGTTCACTATGGACCTCATGACGATGTCT
GTGAAGGAGACTATCACCACTCGTGAATGGGCTGCCAAGGGCCGCTACTCGAACGAGTTCTTCCGCTTCTACTGGCTTTGGTAATTCTAGGTGCATTGGG
ACGTCGCACGGATGGCCCCAAGCACTTGTTGTGGTACGTCAGCTCGGGCTACATCGTGCCACCCCTCAAGTAATTCACAACGCTGCTGTAGATTAGGTTC
AGAAGGGTGGCAAGGCGGTGATTGTCAAGAGCGGCGAGCGGATCGAGTGCGACCACGTTGTTGTCGCCGCCTACGCCGACGAGAGTGCCGAGATGGTCCG
TTGGAGCGAGAAGATGTAAGCTTACCGTCCGCTGAAGCGCTTCCACGTTCACAAGAGTCTGATGTACACCCCGAAGGTTTTGAGCTTGCATCGATCATGC
TTTTAGGCGTGGAGCAACTGGAACGTCCTCATCATAGAGGACGAGCAGTATGTGCTGACATACTGGATGAACTGCATCCAGCGGCTCAAAAGCAAGAAGG
ACGTCGTGACCATCACGCCGCATGTCTTCCAGGGATAGCGTCCGTCGCCGGAGCAGATCCTTGGTTGGGCCGTGGTTTTCATGATGGTGGCTTCGTTGCT
GGCCGTCGTTTGGCTGCTATCCTCCGTGACTTCAAGCACACCCGAACGGCACTGTACGAAACGTACCGAACGAACGTCCGGGACTCGCAGCTCGAACAGG
AGTAAGCGTCATGATGATGAAGGTTCGAGTGTAAGATGATAACAGCCTCGCTAAAAGCCAATTCTTGCTAAAAAAAAAACGTTGTTAAAACTACCCCTAT
CAACCAAGGTTGTTATCTTCGTTGATAAAATTGGAGAATCGATTTATCCGCCTCCCCGACCGACGGCGTGAAGCGCATGGCACCACTGGTGTACAATAGG
GCTTATGGCGCGCTCAAGGTCTTATCGATCAAACTTTGTGCATGAAAGCATCCCTAGTGCCGTCACCTTACGCATGGTTGATAAAATTGTTGCTAACCAG
TGATTGGCTAAAATTGACTCAACTATAAAACCATACTTTCCGGGCCGAAATCCCGATGAGATGATCGTGGTCGAGTTGGAGAAGCCGGTCTTCGTGAACT
TGAGGACGTCAAAGATGCCGAAGTGCGGCTCGACCATAGTGGTATCATCTGGCTGCTCCTATCTTAGGGAGGCAATAATCACTGAAACATGTCGAGGTTG
CACTCTCTTGCAGGAGGATCTTCTATTCGTACGATATCAAAAATGTGTAAGTGCACAGAGCGTCTTCCCACTTGAGTTCAACCGCCCCACCAGCACTTGA
CGTGCGTTTGCGTAGAGTTCTTACGCGCGAGGAGAGGCGCTGCTCCTGGTTGTTCACGTCGTCAGTGAAGCCAACAGCCTCGATGGCCGCCACGAGGTCG
CTGTACTGCGCAGAACCGGAGACGTAGGCAGCGCGTTCGTCGAATTCAACAACTGCGTCCGTCACGCTAGGCGCGTTCTTCAGAGGCTCTGATCAGAACG
TTCTCCACCGTTGTCTTCATGCACGACATATCTTTCACCTGGATCCGTACGGTGGACGGGTCCGTGCAGCGCCACGATCCACGTTCTTCCTGTGTTGGTC
CAGGTTCTTAAATAGTTTAGCGACCAGGTCATAATTATGAGCATGGCAAAGTAGGCGATAGTCATCTGGATCATGTACAGAACTGTGAGCGTCGCCTTGC
ACTGCATCTTGTGAAACGTATCGTGGGGACCGAGCTTGCGCACAGCCAGCAGCCGCTGGCTCACTGCTTCACGCCCCTTGACCAGCGACTCGTTGAACAG
TGCAACGAGGAAACACCCGATGAAGCCGAACGCGTACTTGACACCGCTGTTGAGCACCCACGGCTGGAAGAGCAGCATCAGTGATGCTGCATCACACACT
ATCCGTGAATGGACAGTTGAACATGGCTGATCCTTGACCCGTACAGAAGCCTGAACAGATGAGTCCGACTCCGTGGCTGTACTGCTGGACGACGTCGATG
TTGGTAGCGTCAGAGTACGTGGACCCGCCCTTCGACTCGGCCACTGGTTGATGGCGTGGCCGACTTCAAGAAGGTCGTGTCGGACAACGTCATCAGCATG
TCCTGCTCGGCCGTGATATCCCCACCGTGCACAGCGTCGCTGCCAACGTTATTACCGACGCCATTACTGTCAATGAGGCTAGTAGTGATGGATTTCTTGA
AGGCCGCAACCTCGGCAGCTTCGATTCCTCAGACATCCATCAAATAGTACATAGGTTCTTGGCGGCCTTGAATCGAAAGCTTAGAAAGTTAGTTTAGTCC
GTAGAGTTTCTGGCCCAGAGCCGATGAAGAGGCCACCAACATGGCCGCAGCGGCGGAGAGGGCGAGCACACGAACAATTTGATTGTATGTCGAGGGAGTC
GAGACACGTGCTTCCACATCATGTACAGTTTGATTTGCCAAACATTTCTTCCACGAAATTTTTGCGTGGATGCAATGTCATACTTACATATTTGAATCGA
CACTTTATTGGCGGATTAAAGTCAATATGCACCAGTAGTGGCTTCCTTTTGCTCTCAGTCGGCGTTTCTCGATTCCAGACGTACCAGGTACTTCGACTGC
TTGTCTGCCTAGTTACGTCGTTAGGGGCGTTTAAGAGTGGGCGGGCCTCGAAGGGTGTACCGGGAAGAGGGTACAGCGCCGACGTGTGGTGCACGCTCGT
GCGCTTTCGATTCTTGTGGTACATAAGCCCATAGGCTTGTGCGCTTTCGATCCTTGTGGTACACAGACCCATAGGTTTGTGCACTATCGGTTTTTGATTG
ATTTGCTTTCGGGAACTAGAGCGCCCGAAGCATATAGTGACTGACGTTAACGCGTAGGCTCTTTCATGGTGCTCCGTTTCGGGATTGAGGACTGCTTTCA
TCGAGGCTTTGGTTCGTCACGTTGGCAGGCACTGGCAGGTGAAATCTTGCCAACGTGGCGTTGCTGAGGTCGTTTAGGCGTTCTTCTTCGCGGAGTGCGT
GCGCCGGCGGTTTCGACCACTCCACAAGCGTTGATGTCATCGGTGCTAGTGCGGTCAGCCCGTTGCGAGTCGTAATCCGTGATACTAGCAAGTACGTTTG
TTGCGGTTTGTTGACGAGCGCATGTTTTGATTTCCAGTCCATGACAATCATGGACTGCAGTGTTTCCCCTTGGACTTTGTATACGGTCGAGCCAACCGCG
CACACAAACGGGAGCTGCTGCGGGCGCAACTTCACGTAGCGTGGCTGCCCTACTGGCGCCGGTGAGAGCATGATAGTCGTTATCGTGTACGCTTGTGTTG
CATAAAACACCGGAAAGAGTTCGGGGTCGAGCCCAGGGCGAATCGGGGAAGCCTGGGGCCTCGGAACGCGAATGAGCGCGTAGTCGGAAGGCTGACTTGG
CAGTTGGACGATTGTGGAAGCCGCGCCGTCGCGAACGAGTCGAAACTCGGTGTCAGCAGGGAAGTGGACGTACTCGAGCGTCCCAAGCGTGCCATTCGCT
ACTCCCTTGGCGGTGGCCACATTCTGCGTCACTTGAATGGGCATTCCGTTGACTAGATCCAGATACGGAGCCATCCGGCCGAACCTGTTGTCCGGGAGGC
CGAGCACGTAGGTGAGGTCGCTCCGACTGAGCCCGTTCAGCACTCCCTTGAAATTCGCAACCACACGGATCGGGTAGACGCCGTCCGGTAGCATGTCCGC
AGTCTGCTTCATGAACGCATTGTTAATTACCAATCGCGTCGCGTTCTAGTTTGAGCCATTCGGCTTTGGTCATCATTGAAATCTCGTCGATGATGAGCAA
ATCGAGTGGCGTAAACTTTTCCTCCTTGATCGCGTGCTCCAGTCGTACCAGAAAACTTGCAAGTGTGCGGCCACCGATGAGTGTCGCCGCTTTACCCGTT
AGTGCTGCTTTTACCATAGTGTTGCTGCGGTGCCAGCCTGAGCAAAACGCATTGACAGCGTCAATGACACGACTCTTGCCGGTGCCACCGGCACCACCGA
GAAACATGATCAGCTGGTCGTCTCGTAATCGCGACTCGAAGTCACTGGCGCGATAGTCAGCTGAATTGTGCGCATTGGTGCGCTCTTGCTGCTGGAAGCG
CCGAAGCAGCGCGGTTGCGATCAGAGAGAAGGCTACATGCTGGCGCTGATTGAGCGTGAATGCAGTCGACACGTCGCTTATGCTAGGGTACGGGTATAGT
GATGGTGGTGGTGAGCGACCATGCTGCTAGGCTGACGGCGCCCACTCACGGTTGACTCCAACGCACGCTGGATGAGCTCTATCACGTCGGCGGGCCGTTC
GTTACGTGATCTATCGCTCAGGGAAGCCTCGGCTTCGTCGGTTGCTGAATTCTTGACCCATTCCTGCAACTCTCCCACTGACAACCCAAACATGCGCTCA
TGATTGCCCAGATCAATAGCCGCGCGAACCGTGTTCAGCTGTCATGCCCAGGAGTTCTTGATGGACGAAACTCGACAGTAATGAACCAGTCTTTGCCGTC
GGGAAAATCGGCAGGGTCGAGCCGTCGCCAGTGATAGTATCATCATCATCGGCGGCGAAAACATGGCAGAAGTCGTCGGTTCTGCCGCTGCCGATGCGTG
CCTCACTGTTGCATGGCATGTTGCCAATCGCGCCATCGACGTTATTGCGGGTTCCAAGTAGCTCGTCACTGTCAGCTTCATCGTCAAGCTCGTTACTACC
GGATTCCTCGTCCTCTTGTGCTCGTTTTGATGCGCGGTAGTAGTCGTCCATGTTCGCCATGATTTCGCAAACGAAACTCGTTCGTGTGGATTCCCACTGG
AAGTATGCATCGCTCCATGCAGTCTCGCTCGCCGGATCGCTGACGAGATCCAGGACACTGCGAAATGGCTTAAACAGGACCAGAGCGCACTGGGCGCGTT
TGGCGACGAGCTCGGGAGGTGTTTCGGAATCAATGTACGGCATGCGCACGCCTGTGATGACTTGAACCGCTTCGATTTGATGATGTCTAATGCTATGCGT
ACTGTAAAGCGGATGGCCGGTCAAAAACAAATCGGACGTTGCTGTCGACTCGGATTGCTTGCGGCGAAAGCATGTCATGACGAACTCGTAAAGGCACTTG
TGGTCTAGCGACACTGGCCGAAACAGATAGTCGTCGAAGAAGGACGCTGCGCGGAACGTAACGTTGGACCCGCCTTCTCGCACCTCGACGAGGTTGCATG
AGTGCGTGTCGTGCTGAATCAGCAGGCGCATAACGTCGTAGAGCGGGAGTGTTGTACAGGTAGCGCTCATGTATGCGCACGACCCGCGCAGCAGATAGTG
TGCGGCAAGAGGCCCCGCGATCTCCCGTCGGTTGGTCAGTGCGAAAACCATTGATGCAACGCGTCTGCGCCCAATTACCGAGCGGTCCGCTTGCGACGAC
TGGTTTTGCTGCTCTCGGAGCTCTCGTCGCTTGAAAGCGCCTAACGCTACTGCCGTGACAGAATCGACCAGGTTTTGCCTTTTCGTCACGTACTTTGTTG
TATTATAGATGCGCAGCAGCGCCTTCAAGCCGCCGATGAGCACCTGGACGTCGTGATTCGACTTGAACGCAAGCATCATGCAAGCATTGTAGCCATTGAC
GTATTCGATCGGTACTCGTCGCGCAAGCTCGACACCAGCGCTAGTACAGGATGTGCTAGCAGCTCGCGTTCGTGGGAATCGATACGGACACTGTCCAGGA
GTGGATGCGCGGCTGGCTTTAAAGCAGCTGCCGACGTGCGACCACCAGTGGAGATTCAGCATGAACACGAGTATGGACACCGCGAACGCCACGGCGTTTG
GTGCCCAGCGCTCATCGTCCACCGAAGGCGGCAGCGCAATAACGGCTTGAGCTACTTTAACGTTGCGGAAGGCGTCGTCTTCGCGTTGCTCTTGGCGGTA
TGGAACCGCATTGAGCGCTCGCAAGTACTCGCCGTAGGTGTCGTCATCGCTGTCTCTTGTGGCCAAAAACATATCTCGGCGAAAGACCGCAGCCTTCGCG
GCACCGACATTGCCTCGACAGTTGACTTGCATTTGCACGGCCGCGTCAAGCTCTTCGGGTGAGTACGCTCGCATTGGCGGCGGCCAAGTCGATGGTCGAT
TCTGAAGGAGAACGCGTCGCAGTACGGGCGCGCGACAGACCGCCGCGCGATGTCCTTGCTTCTGACAACGGAAGCAGGTCAGTGGGCCTTGGACGCGGCC
TCCACGACCACCGCGGAAGCTCTGAAAGCCTCGGGGCTTGTCAGACGCGGACGCCTCGACCGCGTCAATCTTCATCGGCTCGGGTGCGCTGACCCGAGGT
TGACGAAAGCGTTGAAGAAATCTTGAGGAAGAGGTGGGGGTATTGAGCGATCCCGCACTCGTTTTTCAAAGTCGAAGGTTGAGTTTGGTGATCAGGACGC
GGAGTTTAGTGTTAACGGCTGGAACGAGCACGGCAATAAAAATCGCTTCATTTCTGATGTCCTTGTGCGGTAGCTCAAGTTTCACAATAGCGTTTACTAT
TGCTGTGCTGACAGGACACAAGTAACCTGTAACCTCTGCAAAAGTATCCGATTCAATTGATATTGTTGCAAGTGTCAAATGCAAAAGTATCCGACTCAAA
ATATCCACCCAAGCAATTGGAGACTCCCTTCTTGAAGGACGACATCGAGTACGCTGCCTTCACCATTTCTCATATTTGCTGAAGTATTCTAACCGCTCCG
TATTATCAGGTCTGTGGCACTCACGTTCCTCCCAGCTCAACCATTGCCAAAGCTCATCAGCCGACCTGCCACGAAGACCCGACGACTTGAGTGAACAGTA
AAAGTGTCCGTGTCGAACCCAAAGACTCGCAGGCAACAGTCAAAACTGAATCTACAGGAAGTACCAAGCCAACCATCGCACCTTCGCTCGTTAGTGCCAG
ACCTACGAGACTCAAAAGGCTGCGGTAAGCAGGCAGCAAGAACACTAAAGCCTTACGCTTCAAATGTATCCATCTTCTTCCGACACCGTTTCGTCGCGGC
TTTGAACACTCAGACTCGAATCAGTCTAAAGAGCTCCCCATGGTCTCTATGCTGCTCACGTGTGTGGACGTCGTATGGCGCGAGCAGGAGGCTCTCGGCT
TCCTCCCACACGTGGCCGCACTGATCTCTTCCTTCTTGGATAGTTCCCACCTCTGGAACATCCCGCAAGCCTTGGATTACGGCTATCTGCATCTCCTGCA
GCGTCTGGGCGCCACTTCGAGGCGTTTGCGGCCGCTGTCGAACCGTAGATGTTTCCTATCTGCAGCTCAGCGAGGCGACATTGCACTGTTGCAGTGGTTG
GCAGTGTACGACCCCGAGTTCCAAAGTTATGGCGGAGTACTGGACCACGCGGCGGAACATGGTCAACTGGAATGTGTCAAATGGCTACACAAGACCATCC
CGAACCTGCAAGCCACTACCAAAGCCATGGACTTGGCGGCAGCACACGGACATCTAGCAGTTGTGCAATGGCTACATGAAAACCGGAGTGAGGGATGTTC
TTATCATGCTATCGACGAAGCAGGAGCTAGAGGACACGTCGAGGTTGTACAGTGGTTGGCTGCTCACCGTAATGAAGGCGGCACGAAATACGCAATGAAC
TTTGCAGTGTGGTACGGGAACACACGAATGGTGCATTGGCTGTATGAGCATCGTAGCGAAGGCTGCAGTATCCACGCTATGGTGTTCGCGGCGAAACGTG
GAGATCTCGAGCTACTCAAGTGGCTCTACGATCACAAAGAAGAGCTGTTGGCCCCCAATGCAGACGACAGCTCACCGCTGGTCATGGACCATGCAGCGGA
GTACGGACATTTCGACGTGGTAAAGTGGTTGCATGTCAATACAACTGGCGGATGCACAACGGACGCAATGAATGGTGCAGCTCGAGGAGGACACTTGGAA
ATTGTCCAGTTCCTGCACGACCATCGCTCGGAAGGGTGCACCACCAACGCTATGGACGGCGCTGCTCGAGGTGGACACCTGGAAGTGGTAAAGTTCTTGC
ATCAGCGTCGTAGGGAAGGCTGTTCATACCTGGCAATGGACTACGCAGCCGCTGAAGGTGATTTGGAGGTTGTACAGTTCCTCCACTCCCATCGGAATGA
AGGTTGCAGCCCCTGGGCGATGAACTCGGCAGCAGGTGGTGGCCACCTTAATATTGTCAAGTTCCTGCATGAGAATCGCACTGAGGGGTGTACGGAGAGG
GCAATTGATCGTGCAGCAGGTGGGGGTTATCTTGCAATTGTGCGTTTCCTCCACGAGAATCGGTCCGAGGGGTGTACGACGGAGGCGATGGATGCAGCTG
CATGTTTTGGTCACTTGGAAGTCGTGAAATTCCTCCATTTCAGCCGGAACGAAGGCTGTTCTCCAAGTGCAATGGACTCTGCAGCACGTTGTGGGCATTT
AGACGTTGTGGAATGGTTGTTCGAAAACCGAAGTGAGGGCTGCTCGACTGAAGCAATGGACGGAGCCGCTTGGTTTGGACACTTGGAAGTGATGCGCTTT
TTGCATGAAAACGGACGTGCACGGTGCACAAGACGAGCAGTTCGGGATGCTTTGGTCGGCGGTCATGTCAAGGTGGCTAGGTGGCTTGTAGAGAACTACG
CGCAGTGTCGAGTCGGCGGCGTAGACGTAGTCGGTTGAGTTGGAACTATCTGTATCTGTGAGCACTTTACGGACTGAATGGCATTGTTTGAGACTCGAGT
GCATCCGTATCCGTTGTTTGTGGGAAGCAAGGCGAGTGATGGGTCCGCCACTTGATTTACACGCGCTCCATGTCAAACAGCGGATCGAGGATACGCTGAA
TACCGTACGCAAGGGTAGCCGGACAACCCCAAGCAGAGGTCTTGCGTTTTTGTGGCGTACATCTTGTCCAAAAGAGAGCAGTGTCAAACAAGTGCCTGAT
GGATGGAACTTCTTGGTGTTGATTAGCACGTTGCACTCGATGGAGAAGCGGTTTTGACACTGTGGAGACCGGTTCAACCTCGCAGGGCTCGTTGAAGCCG
GCAGCTGCAACGATCTGCTGCTCGCAACTTGTGACTCGCAAGTTCGGCTTCTGATATTGACAGAGACTGTAGCAAGTAGTTGAGCCACTCCGGTGGCAAG
ACGGCTCGCGAAACGCGTTTACATACATACATACATACATACATGTAGCAAGTATGGCCTCCGAGGATGAGTCTCGAGTTGACCTCCTCCAAAGTATCCG
GACTGCTGCAACGCCGCACTCAACCAACGTCGATCACAGGCAGCTTTCGACTCGAAGACAATGCAATGTGGCGATCGGTTAGGCCGGATACGATGCTGCT
TCCCATCTGGTGGTCAAGCTTCAGTGGACCCCGTCAACCTTTGACTGCATCCCTCGACTTGCGTTCGTCTCCGTTTGTGCCGTGAAGCTGCGGTGTCACG
GCTTGCTGAGCAACATCCTGCAGCGGCAAATTTCGTCGACACTTCTCGCTCCGGACGCTCCAGCCTTCGACCAACGTGCCGGTCATGCATTTCCTTGAGC
AGACCGCGGAGATCAGAGAGCCTTGAGCGTCAGACTTGGACTCAAAGAGAGCTTCGCCATGGAGCTGGCCAGGCGTCAACACTTGCGTCGTGTCTTGTCG
TACCCATCCCCCGAGCGCTGGTCAACGAACCTCCGCAGGCGCTCAACAAACCGTTGAGCGCTCACGCCACGGACCAGCTCGACGAGTGGTCTGCGCTCGG
CAGCACCGTTGGCCCAAGTTCGGCGCCGTCGTGACTGCCCCATCTCGGTGCAGCGGGATCTTCTTTGGGCCCAAATGACTGCCGTGCGGAGAGTAAAGTT
ACCTCGTCAAACAGGAGTTCTTGGGTGCTTTTCTGGTGCTTTTTAACTTCATTTTCGCGTTGCATCCTCGCGATGAACTCCCTCCTCTCCTCGTTCACCT
CAGATTTGCATGTACCTCTTGTCGAGGCGTTAATCCTTGATTCAATTGCTGTGTTGCCGTAGAACCTAAGGCCAAGTGTAGGTCTACATTATCCAGTGTA
GATGGTGTCGGGATAGTCGAAAATGATAATTGGCATACAAATAACAAGTGTAACTACTGAGTCTGGATCACTTGCTATTTGTATGTCTGACTCTCAATTA
CTTGAAGTTGGTATCCGACACAGATACTATTAAAAAACAGCGGAGACTTTCGTCGCCGAAAGCTCGTCAAGAGTTCACTTTGTCATGGCCCCACTCTGCT
CATCCTCCTGCACTATCCGGTTCTCGCCTGCCCTTGCGCCTGTATCACTGACGTGGTCGTGGTCAAGCAAGCAAGGCGTCAAGCTATGGGTCAGCACCGC
GTGTTCGCCTCGGAGCCTTTTCTGCATTGTTCGATCACCCGGGGAAGCCAAACTGTGTTAATGAGTAGTGGCCACACGTCTTCACGGCGCTCCAACAGCT
CGGACAGCGCCTCCACCGTCGCTGGACCGGTGAGCGTAGCAGGCACCACTAACGGCTATGGCTTCCGTAGCGCCGGTGGCGATGCGTTGTCTATTGAAAT
GCAGTTCCTGAACCCGCGCCGGCGGTTCCCCCTCGCGGACGAGTTTCTGCCAGCTGTAAATGTGACGGAGGAACAGGTGGAAGATCTTCGCGAGACGTGT
GAGCAGCTCACAGCCGATGCGCTAGAGCTCGCCACCATGTTCGCGTGGGAGGACAGCAACAACAACGACCTGGTGGGTGAGCACCGGGAGCAGTGGAAGG
TGCACTACAAGAAGCCGCACGTGACGCTCTACCGGAAGAAGCGCGGCAAGGATGTGGCCGTAGATGAACAGGAGGACGCCACAGATTCTACCAACGGCGG
ACTACGACACTACGTCGTTAGCGGACAGATCCACGACATGAGTCTCGAGGATGTCGAGTACGGACTCTACTGTGATGCCACGCTGGATGAACGCGCCGTC
ATGACGGACTTGTACCGTGAATTGTTCCTGGACGCAGCGGTTCTACGTAGTTTCGAGACACAGACGCCGGAAGACCCGTTCCACTTCTTCGGAATCAAAT
GGCTGGCCCACTTGAGTCCAGCCGACAAGTTCATTTCGCCTCGTGACTTCGCCTTTGTCGAGTACTCGCGGCGTGTAACCGGTCCCAAAGGCGAGCCGCT
GCTTGTCAAGGTGCAGCAATCGCTCGGTCCCGAACACGTCGACGCCATGAACCGCCGTGAATTCGATCTCGTGCGTGCTCGGATGAGCTGTACGACTGTG
TACCGCCACGACAAGCGCGCTAACAACGTGCAGGTGATCGCTCGCGGCTACTTGGACCCGTGTGGGAGTGCACCAGCTATAATGACGCGCTCCTTCCTGA
CACGCTTAGCGCCAACTCTTGTCGAGGTTGAACACAGCGCCGACGTCAAGTATATTATGCGCAATGGCTTAGTACTGCCAAAAGAGCAGTTCTTCGCCCG
CCGTAACGCTTTGAAGGCCCATGGACGTCACCGTCTACAATGTACAGCTTGTGGTAAACGCTTCGGTCGTCTAAAGCGCCACTTGACTCAATGCCGCGCG
TGTGGTGAAGCTGCGTGTGGTCGGTGTCTCATGACGTACACTTTGTGTCTTCCTCATCACGAGCACCGTAGTGCGGAACACCCGAGTGCAGTGATCCCCG
AACGCTTCTGTCTGCGTTGTCTGTATTCCGGTCGTCTTGATCGAAAAGGGCAACGCATGGACGACTTCCTACTTGGCGGAACGGTGGTCGCATCCACCAC
TGTGCCAACCGTTGACGACGACGACGAAGTTGACGATGACGACGAGTCTGTGGTGGAATTCGCGATGCTTGGTGACGGCCCTGGAGCAATGCACGCTGCC
ATTTCGGAAGCGCAGCGCTTGCAGCGCCTGAAGCAGCGGTACCTGGAAAACGAGAAGCGCAAATACCTCAGTGGACATCAACATACTCCAGTGCAGCGCT
TTGTGGAGCAGCAGCACCAGATGCACCACTACGAGCAAGCGACGCGTAAAGCTCGTCCTCCAATTAGGAGGAGCAGCCAGCCAACGCTGAATGGCAACAA
CTCGGTGAGTTCCTCCTCCGTCTCGTCAGCACACAACTCGGCTTCATCGATGTACAGTTCGCTGTCAATGGGCAGCTCCTCCACGTACTCGTCAGCTGAA
GCAGCGGCAGCAGCTACGGCAGCACTGCAAGCTAACACTGGTTTCCACGAGATGGAGCACTCTATCGGCCAGCAAGAGGCGCTGTTGCGTTCGCTGCAGA
GCGAGTACGCCAAGATGAGCATGAACAGAGCGCAGTCAAATCTGAGCTTCAATGCGCAGGAAATGCGAGAAAAGCGTCTGGCCGAATGGCAGGCAGCTGA
ACGCTCGAATTCCACGCCAGCATCGATGTCCAACCAGTATTATGACATTGACGACTAAAGCGTCGTGAGTAGTATTTTCTTTACAGCAGTGAGTGCGTGA
ACGTAGGTAGCTAGTATGGCGCAGAGCCGATTCTTATTAAATTGATCAACTTCATGTAACCGTAGTTGAAGCCAGGTTCCTGTCTTCATTTGGGGAAAGA
ACTAGCTTTTTAAAGTCTTGTTCTTATTCTTTTTGAGCTTCATTTCAAGTTCTTGTTCTTCCTTTTACAAACGTCGTGTTCTTGTTCTTGCAATTTATGT
AAAAAATACCAAGAACAATATCTGCACAAAGTTTATAACAAATGAACTTGATAAATACTTCGAAGTACACTTAGCTTCTTACTACATGTAGTATAACAAA
ACAATTTTGCTCTCAAAAGAATCCAATTCCCAACGTGTTCTATGATAAAACATGGGACAGTAAAAGCCGCAAAAAAAATGATATCTCTACCTGTGCACTG
ATCAATACTTGTGAGCAGCATTCATCGCAACAGTCGCGAAAAAGTCCACGTTAAAGTCGAAGCCGATTGCATCCAGATGCTCTCTATCCCTCTCCACAAA
TGTGGAGTATGCGCCTGTGTGCCGGATTTTCATGAAAATGTTTCCAAGTCGAAGTCCGCGAGTTGCTTCTGGCCAAGGCGCTTCATCCGGGACAACGAAC
CCAACCGAAATCCATCCAGTCCCGTATAGCGCGTAGTATGTCTCGAGAGCCGGCATGATCACGTCGGTCCATTTGTGCTCGTCCGGGGACCAAATGAAGC
CAATCGCCTCCAACTTGTCCTTGTCTCGCTCCGCCAAGTCAACGTAGTTCTTTCTGCAACGCATATTGGCGACGATCGCTCCCAGTCTAATCCCCCAAGC
CGCCTTTGGCCACTTCTTGTTCCTCGGCACGACAAAGTTGAAATTCACGTTGCAGTGTCCGAACTCGCTCTCAAATGTCTCCAAGGCGGGTAAGATCTTC
ATCTCCCACTGACGCGCCTTCCAGGACTGCGTGGTATAGCCGATCTCCTCCAACTCATCAGCAGCACGCTTCCGTTGGACTCTGTACGAGTCGCCATACC
TCATTCCCATGACAGTCTGTCCGAGTTTAAAACCCCACAGTATCTTCGGCCAGGCTTCATCCCCCACAGGAACCACGAACGAGGTGGGCATGTCGCAGTG
CTCGTTGATCTGGAAATATGTCTTGAGCCCAGGCAGCACGAGGACGTCGAATTTGTGTTGCCGCATATCCCACGGGAAGTTGATGGCTTCCAGGTCTTCG
ATGGCGAAGAACGGGAGATTCTTGCCTTGGTGACGGAGTGACCGCAGATTCTTGCAGTACAGGCCTAACGGGTAACCCCATGTCTTCTCCGGCCATGCTG
TGTCTCCATACGGTACTACGAACTTGTGAGGGACGAGCAGGTGCTTCTCTAAAGCCAAAAAAGTCTGCAGACTTGGGGCAATCTTTTCGATCCATTGGCG
TGCGTTATACATATTGATTTGGGCGTGGGCGTGCGGTGATGTCGTAGCAGAGATCCCCGCGCATCGGATAACACTTGATTTACCGCCCAGGGAAGCCTGT
GAGCGACGTGCCAAGCCGCCGCGTGCAGCTAGGAATTGGCGCAGCATTACGCAGAGTAGTGGTCGAGGGAACTAGAAATACGTCACCGATTCAGGCTATA
TGTACATAATTTTGTGTACGCTTTGTGAGTTATGTGAAGTGGTTTACATAAAGACAAAGTTGAACAAGTAGGAGTGATTGTCGTTGGTGAACGGCATGAT
CTCATGGTGGTTTCTTCCTTGATGTAGTGTGGGAAGTGTAGATGTATATTGATGGTCAGTTGAGTTGAGTAGCGATGATGCTGAAAGTGATGTCCATTGC
CTATTTTAGGTTGTGTGCGATGCCGTGGAGAGAAATATCGTCGGAGCAATCGCAGCTCAACGGACTTGACCTTGGCGGATTTGGAGACGTTGGTCCAGTT
TTCCAATCGACTGCTATCCCTCACACGCGAAAATTTCTTTGTCGGCTTAAACAACCGACGTCTGCAAAGCAAAGATGATGACAGAAAGCAACAACCTGCT
GTACCACCCGAGTGGCTTCGATCGCCTCGAGGAAATGGAAGGTGGGGCGCTGACGCGGTATCCAGTTTTACGATCAGTTCCAGTCCCGATGACACGTCCG
TGGAGCACACGTGGAGCGATCGCGCTCCTCATGGTATGTGGTGCGGTCTTCGGAGTCATTGCCATTGTCTCTCTAAAAAGCAGTTCTACAAGCGACACTA
CCACTGCAGAGACCACCAGTGCGGATAGTACTGGAGGAGGAGTGTCGATCATTGGCGGGTCAAGTAGTGTTGGGGCTGGTAGCGTGGGGAGGGAGTCATC
GTGGGTGGATGACTCCGACGATGGATCAACGGCCAATGATAAAACGAATGACAGTTCAAGCGGCTCGAATACTGGTTCACCAAGTTCTGAGGGGGAAGAA
TGGGGCAGCGCGAGCTACAGCGCATCCAACTCGTTCTTTGATGGCTCTCAAACTAGTTCGCTTGAAAAATGGGTTAACTCGCAATCCGGGTCCCTCGAGG
ATTCAGCGTCCGATGCGTTCGATTCCGAGAGCACATCAGCGGATAGTGAGGAGAGCGCTTTGGTCTTGGGCTCAGGTTCCTCGGGTGGTTCTGTGGAAAA
TTGGCTCTTCGAGTCCGCTTCAGATTCACGAGACGATTCGACGGATGGTAGTGCATCTACGTGGCAAAGTTCATCTTCGATGATCGACGAGGATAACGAC
TCAACATCTCTATCGGCAGACAGCTCTCAGAATTTTTTAAGTACACTCAGGAATTAGGACCTGTAGCCTCACTTGTTAGTGCAAGTCCGTGCGATACATA
CCAATATGCAAATACATACTTTTGCCTGACTTCGAATAGTGTTCACGTCTACAGTTCAAGTAGAGCTCTTCTTTTCAGGGATTTTAGCTCGTCCGCTTCA
ACTTATTTTTCAATCCGATTAGGGGACTCCAATTGGCTAATCCAGACCCCTTTGCCTCATTTTAGATTATGGCAGTGGCGAAAAACCTGCTGGCCGTGCG
CGCCAAGGTGGCGGAGGCTGTGGCCAAGAGCGCCTGGAAGCAACAATGTACTCTGGTGGCAGTGAGCAAGACTAAGCCTCTGGAGGACCTGCAGGAAGCT
TATGAAGCTGATCAGCGCCACTTTGGGGAGAACTACGTGCGTGCCATATTTGAATTATAGTTATTTTTAGTTTGTGGCGCTAATGCATTTATTTGTGGTA
AATTTTGACACACAGATCCAGGAGTTGGTGCAGAAGGCGCCGTTGATGCCCGCGGACGTTAAATGGCATTATATTGGCCACGTCCAGTCTAACAAGGCCA
AACCACTTGTGCGTGACGTGCCCAACCTCTTCGTGGTGGAGACTGTGGACTCCATCAAGATCGCCAATGCCCTGAACAAGGCGTCGGGCGAGTTCCGCAC
CGAAAAACTAAACGTGATGGTGCAAGTGAACACCAGTGAGGAGGAGCAGAAGTCGGGTATTGAAACTGATGGTTCGGTCGAGCTTGCCTGCCACATTGTG
ACGTCCTGCGAGCACCTAAACCTCACGGGTCTCATGACAATTGGTCGCTATGGTGACACCACGTCCGAGTGCTTCGACCGTCTGGTGGCCTGCCGTAAGC
TTGTAGCTGAGGCAATTGGCAAGGCGGAGACGGATCTCGCCCTCAGCATGGGCATGTCGGGGGATTTCGAATTGGCGGTGAGTACGGTTTCGTGTGGTTA
CACGGGTGACAAGTGTTCTAATTCTTTTCTGTGTTGTAGATTTCGTGCGGAAGTACACATGTTCGTGTCGGTTCGACCATCTTCGGGGTCCGCAACTATG
CCAAGAAGGACTAGGGTTGAAACTTCCGTGTTCGCAGTCTTAAAGTTGTGCTAGAGAAGATCAAATGCCAATGCGGATTGCAAATCGAGGTTGCCGTTCT
TGTTCTCGGCCCATTTCGCTGCAGCGCGCAGTGCATCCTCCGTAGGCATGCACTCTTTAGCTGGGTCTTCGTCTTCGTTTTTCTTCTCCTGGTGACGGTC
GAGTCTTTCTTTTTCCTGCCGAACGATGTCTTCCATGTCGATGTAGGTCGTTTCTGGCTCATTCGGATACATCTCACGCCACGTCTTGCCGGCCTCTTTC
GCCTTCTTCTGCATGTCCTCGACCTCAGTACGTCTCACCTTCCGCTTCTCTTCAGCTTCTTTTGCCTTTTGCTCACGCTCAATTCGTCGCTGCTCCAAAA
TATGCATAGACATCATATCTTTGCGGTGGAATCGATCTTCAGGCAGCTCTTCGTCGTCCAGTACAGGATCCCACCGTGGGGTCTTTGGTGCAGGCCCACT
TCCAACCACCCCGTCACTTGACTCCGCTGCATTGGCAAGATGGAACATCTCCACTAATGACTTGGGCTTCTCCTTGATGGGCGTCGATCCAGCTTTGTTG
CTTGACCCATTTTCTTCGCCCAGTGCCTGGGCAAGGAGCCACGGTGCCGATCCGCAGTCGGGTCTGGCATTATCCCAGGATTTATCAATTGTAACTGATA
TCTCAAGTGTGTTGCTGCCTTGGTTCAACCGAACTCTTGTGTCGTTAACCTCTACAGGATACGGAAGAAAGATTTCTGGAACAGACCGATGATGTAAGAG
ATACGTCTCCACATACATTATAAAAGCATCGAACTTACCCAAATCATGATGAGTTGCAGCTTGTACACTCAACAATTCGGATCGCAACTCCAACTCGATG
TCAGTTGTCTCTACTTTGTTTGCGAACTGAACGGAGACGACCAACCGATCTCCCGCTTGCTCCAGTACCTCACGTGATAGTGGCGTGCTATTCTTCATAA
CGGAAGGAAGTCTTGGGCAGACTGTTCGCTTGTCGTTCTTCTTTTCAAAAACCTCGTAGCGTGCTGTAGCTGTCTTTGGGGCGAGTAAAGTCTTGGTCGC
TTTCTTCGCTCTGGGTTTTGCTCTACCCGCCGCCTTCGAAGTAACTTCTTGGATAATTGGTGCCTGAGTTTTACGGATGTAGTGCTTTGGCGGGGGTAGC
TCTCCTCGGTATGTCAGCCGTGGTAGTTTATAGCGACCATCCAATTTGATTTTGTACTGCATCAATGAAACCATTAAAACTTTTCTTGACTGTGTGTGAA
ACAAACGGCGTCTCTTACCTTCTGGTCGATATACTCGATAGCCAATTCGCACACAAAGTTGCGAAAAGCGCCAGTTTTGTCTGTTTGGCAGTCTTCCACA
ACTTTAGTGTTTACGGCTACATCAAAAGCCAGCGAGATATCGCCCTTCTTGTCCTTGACTTCATGGGGCGCTCCCAGACTTAGTGGCACGTGAATTCCCT
ACGCACACACGCCATTTCACGTCAGTTGAGCCTGAATCTCTTAAACAAATCCAGGTAATACCTTCCTTACCTCTTGCTCTTTTCCCTCGTCATCCAGCTT
CTTCTTCTCCGAAAATTCTTGAATTTCACCAGCAAATACTACATTCACGAATACCTGCCATACCAAACATCAATTAGGTATCCCCTCCTAAAAAACAATA
AATGAGCCTATCGTGCCTTCTTCTTGCTCTTGATTTCCGTTGTCTTCATCACAAACCCAGGTGTCACATCAATGTACACCTGTCATACATGCCGAGACAA
ACTGGTTGATAATCGCATTAATCCAAGCACATTAGCATCGCCGTACCCCCTCCGGCGTAGCTTTCAATCCACCCTCCCCCATGACTTTGTCCCCAGGAAA
CTTTGGCTTAAAGTCTAGCCACAGTTCAAGTTAGACGCCAGATACTGCAGTTTTCTACGATCTACGCATCAAACCTGGCGAATTCGAATCCAAAGCTCCC
TGAGCACCAGCTGAGCTCTTGAGCGTGTCGAATAGTGCTGCATCGGTGTCTCCTTGTGGCGCGCCAGTAGGACCGTCGGATCCCAGTCCTGCAGCTTGTA
GCTGGCTTTGCATCGTGGCAATAAACTGCTTGTAGCCTTCCGGGTCCGTCTTCTCTAAATTGTCCAGCCACTGTGCAACAACCACAAGGCGGTGAGAGTG
CGTTCAACCTTCATCCTGCGCAGAATCAACAGCTCTATGTCAGGCACCGGCAACGGACAACGTACATCGGCGTACTGCTCCATGGCAGCCTCGTCCATTG
GAGCGTCCATTGTGTGGCGAAAAGTCACGAAATGGATTTAAAAATCCGAGCCATTCCTACATTTTAACTCCAATAACTTATTCAATAAGTTATTGCCAAT
AAGTACGAAATATATTGGTTAAAACCGGTTTAAAAAATAATATTTATATATATATACGAAATGAGTCATCAAAGTTTTGATGGTCAAACCTGTTAGAACC
CCCAGCCATCGTCTTCCTCTTCGTCCTCGACATCCAGGTCGTCGTCATCTTCACCTGAAGAAACGCCCCCTTCATCATGTGCACCAAGGAAATGGTGGAA
AATATTCATGAGTCCCTGGGGCATTACTTGGTCGCAGGGAGTGTCTTCAGTGTAACAGTCGTCCTCTTCCGATTCCCAAAACACTTCTCGATCCTTGTCC
TTCGGAAGCCAGCTCATCGTGAACATGTCGATCTTCGAGAACGAGTCCCCCGATACCCCATTTACCGAAGCGTTGACCATGACGGACGGATGCATCTCCT
TCACGCGTAGTATCAACGGCCTCAGCTCCTCACGCATGTACTTGGAACTCCACTGCTTGCCCACTCTCGCGTGGTACGGGTTGGTGAGGAACACTTGAAA
CTTCTGCTTGTTTGCTGCTGCTCCAAAATCCTTCTCGCTGATTTCAGAGAGACGACGCAACAGATCCACAACCACCGAGTAAAACGTCGGCACACCGAAG
GCACCGTTCTGCTGGCCCCCGATCGGTAGAGCCAACATGCGCGATTTACCAGTGTGGCAGTTCAACTCCAGAACTCGCTGCATGTAATCAAAGATGCCAT
CCCCTGTGCACATGACGGCACCGTTGCTTTCCACTTCGCGCAAATTCTTTAGCTTGGCGAGGTAACGTAGTGACTCATCTGTGAACGTCTCAATAGGACG
TACGTTCATCACCTCGAAGTTAGAGCAGCTACGGACAGCGACCATCTCAAGCAGAGGGCAGTTCTCAGCCACTGACCGCCAAAATTCATCGCCGTAAATG
TCCATGTTGAAGCCGAGTCGGTGTATTTCTGAAAATCAATCTCGACAGTGAGGTTTGTCAGCGCAGGGCAAGGAACAAATTCCCCAAGCATTCCTCGAAT
TACCAGCAGTCGGCTATGTCGCCCCCTTCGTTGCCTACGCTACCGCTCTCCCTCTTCTCACACGTGATGGAGTTCGTGCTGTACGACTTCTCGCAAGACT
TGTGGCCTTCAGCGCGCTCTCACCCCGGGGACTTCACGTCCTATCCGGGAAAACGCCTGACAGACGTGGCCATGGTCAGCAAGAGCTGGTTGCAGCCCGT
GAAGCAGCTGATAGCGCAATACGAGCGCGAAACAATGAAGATCCAACTGAAAACCGGCACCAAAGACGAGATTGCCAAGGTTCAAAGCGCAGTATCGACT
CGAGGCGCGGCGGTGCGCGACCTGCGCGTGAGCATTGGCGAGAAGAGGAATACGGCTATGGGACAGACTCCTTGCTCCCTACTAAGGCGACGGAGCAGCT
CCAAGTGGACTGGAGCGCTCTCTTAGCCAAGATGCCAGGACTGAGACGCCTGGACTTAAAGCTGGTCCCATTGCTCAGCCAGCATTTGCCGAAGCTGTTA
AAGGCAGCAGGAGACCACTGTGTTCAACTGGAGAGTCTGGTATTGCCCCGCAAGCCGCAGTTGAAGGAGATTGTGGAGGGGAAGAAGATCGAGACGGTGT
TGAAGACGCTTTACGCTACGTTGGAGCAAATATACGCGAGAGGAAACCGTGGAGGACTGAAGCAGTTGACGGTACCGACGAGGAACGATGCTGAGAGACA
CCGTTCCAGTGAGGAGTTCCTTGACAACGTGGTGAAGTTCTGTCCCAACGTGGAGTATTTAGACGGAACGGATTGGGCTTGCCACGACTCTGACGGAGCT
CGCTGTGAGGACAAGTGGATGGTGTCGTTGAAGACGTGGGAAGAGTTCAACAAGACCTGCACGAAGTTGCGCACTTTCCACTTGACGGCTGTACCATTTG
CTGATCCATTCTTCCGCGCTTTTAGCGAGACGCCCAAGCCACAGCTGGAAGAACTTTCTATCTCTGCTAACCTGCTATGGAGTTGGAAAGAGTATTTCCG
GGGATGTGGCGACGAAACTACTGCGGCGATCAGAAATTGTCATGGACGGCGCGCCAGGGATGTCGGGGTTGTGTTCAAGGCTGCCGAGCGCCATGAACTG
GACCGCGTGATACCCCAGATTTTAGACTTCCCGCCCCGTACTACCGTTGGATAAAACGGATAAAACGGATAAAACGATAAGTTTAGCCGAGAGCTTAATA
AAATGCTACACAGAGGGGAAAAGAGCGGATGTGGATTTGACTCGTTCTTTCATTTAGCCCAGCTCGTTGGGGTTACGACGCGCCCGGGAGCGACTGCGTA
AGCTTATCCGCAAGGCAAGCGCAAGGTCCCAACAATGCGTTCGTAGTAATGGTGTGAAGCGCACCGAGAACCACTTACATCAGGTCCACGAACGGCTGCG
CCGCCATGGTGATGGGCTTGGTGCCCTTGGTCTTCAGGGTGTAGGCGGCCTTAGGCTGCACGGGGGTACGCTTGATCTGAGCGCGGACGCCAGTGGCGCG
AGCCTCTTTCTTCTTCAGCTCGTTCTCCTTGACGCGCGTGAGGAAGCCAAGACGGCACTTGGACTGGTGCACGTGCTCAATGCGCACGTTGATGTGCTTG
TGGATGATGCGGTTGCCCACGATCTTGTTCACACGCACGCCGACGGCACGCTTGGTCACGTTGTACACACGGCCGGTGCGGCCGTGGTAGAACTTGTGGG
GCATGCCCTTCTGCACGGCACCGTTGGCCTTGATGTCCACGTAGTCACCGACCTTGAACGTACGCAGGTACGTCGACATCTTGATCATGCCGCTCTGACG
GAACGGGCGGGCGAACATGTCGCGCGTGCGCGCGCGGTAACCGAAGGAGTGCGGCATCTTTGACTAAACTGCAGGAAGGAAGACATATCCGTTAGTAGCT
GCATTTCCACGCATCATCGGAGCGATCTGAAGGCTACATCTAGTAGAAGACAGCGCTGTGGAAACAACTGCAGTGGGAGCCGCACTGGAAACACCGGAAT
TGCGACGGAACGAAGCATTCTTCGCCTGTTATAGTCTCTGTGCTTTTTGGCCTGTATCTCCGTCATTATTCGCTCGCTGTTGTCCGTCTCCGCCCCATTT
TGATTGGTGTATCTGTGCCCCCACTGTTCGTCGTGTCCACATGCTGCGTCCCCCAGTAGATACGGCCAGCCATCGCAGCCAGGAGAAGCCTCGCTTACCT
GCTAAAGTCGAACGAGACAAGATGAACTGCGTGAGCGATGGCAAAGGCTGGGGCGTTGGCCGTGAAACTATTGGCCGCGGAGGCGCCAGCATACTAATAG
CAAGTGTAAGACCCCACGAGCCAATCACCGTGGGTTCGGACTTTGTCGGGATAAATACTTTGAGCTCACGACTAAGTACGAATATGGGCTGGTAAACCCG
GCCCGTTGTGGGTTCGTACTTTGTAGAGACAATAATTATTGCTTGTTCACAAAATACACCCCTCCATTATTGGTATCGGAACCATGGAGGACGAAGAGTT
CGGGGAAGAGGTGCTGGTGACCACGCGTGCAGGCGCCAGCGTTAAGGAGGAAGCCAAGACGGAAGACTCTAGAGCCACATGGGAAGCTAACGACGCACCT
GCCGTTAAAACGGAGAAGAAGGAGGAAGAGGAAGACGAGGACGAAGACGAAGAGCTGTACGGGGGCGTCTCCATTAAGCTCAACGCTTCTGCCACATCGC
AGGCCGAAGCAGCGGCTTCTGCAGCTGCCAGTAATGTACCAGCGGGATCCAAGCCTAGTGACGATCCAGCGGCGGACTCGGACGACGACGAGGACGATGA
AGATGTGGCCATCGTGCTGAGCACGGATCATGCCGGCAGTAAGCCCACGCTGCGCTTCACGGGCGGTGGCAATCGCTACGTTCGCGGCAGTTTTGGAGGC
ACGCAACAGGGCGGATCTGGAGCTCCTGGGGCTGGAGCTATGACAGGCTCTCAAACGGGGGATTTAAGCGGATCTGCAGCAGATGGAGTGGACGATATGG
CCATGTTCGGCGGACGACGGACGGCCTTTGATGTGGATATCGACCTGCTAGAAGACAGACCCTGGCGCAAGCCTGGTGTGGATATCTCGGACTACTTCAA
CTACGGCTTCGATGAGCACAGCTGGAGAGAGTATGCCGCTAGACAGTTGAGATTGAGACGCGACTTGGCAGTGGAGAAGTCGAGAGAGCAGGCGTCCAGA
CAGGCAGTGAATGCAGCCAACCAGCAAGCGATGAGAGAACGAGATGCCAAGATGCAAGGAAGGGGGG