Description :
From Genome Similarity Track
Location :
contig_10:638890- 640465
Transcript NameFunction/comments
g3389.t1hypothetical protein

Sequence
1575 bases(100 bases per row)
AAATATTGGACCAGCAGCGGCTTCCCGCCAGTGCTCTCAGAGTCATCTCGGAGGGCAGCACGTCAGCTGGAGGATTGACGAGCCGCAACTACAACAACAA
GCACGCTGCTGTTCGACTGCGCGCAAATCCCCAGCGCCCGTCGCATGTGGATCCTCGCGCTTGAAGCTGCGCGCACCGGAACTGGTTTAACGCCTCTACG
ACATCCGCATGCTTGGCGCGGCTGGTGCAATGCCCGACTCCCTTTACTGCAACTTGTCCGCTTGAACCTCTGCGCGCCAGTCAAGCCCGGGAGCTCTGCC
GACGGCATCGTGCAAATTGCGCCGCCCCCATCCTGGCGTAAGCCGCCGGTTGCAGTTGCAGGAAGACACACACCTTGCAGCTTGACGGTCCGAATGCACC
GGAAGTGGAGTCTTGTCGATTGTTGCACGTCCTTCGAGATGGCTACAGTTCTGCAGCACGAGGAATCGCAAACTGGAGCCCCCACATGCTGAGACCGTGA
GGGGGGGGGGCTGCTACTTTGAGGGACGTTTGTCCAATCGCGAGCGATGCCGGTCCACGCAATCTGCTGCATCAGGCAAGCGCCTTTGATGCAGGGGTTG
GCTCGCGAAATGGTCCCCAGCCTGCACTTGCTGGGTGTCCTGGGGACCATCTCTGAGGAGCAACAATGGTGCGTGGAGGTGAATGCTTAACAAGCGCATA
CTGAGGCCAAGTCACTCGGCATCTGGTCCCACATTGGCCCGTTTTGCGCAAGCACGAGGATGGGCTTTGCGAGTGAGAAATCAACCGACGTGCAAGACAA
GCACCGGCAGCCTGGGCGGCCATGCAGGCACCTGCAGCAGCAGCCCAATAACATTAAGCAGCTCTGCCGCCTCTGCATCGCACGCTGGGAAGAGGACGCC
AAGCAATAACGCCATCCAAGTCAACCGAAACGGATGGCCAACACGGAAATCGGATCTAAGGCAGCGCAGTGCAAAGAACGCTCAAGATCGCCACGCTTTC
ATTGGCTCAAATTCTTTATCTGGCCCCGTTTCTGTTACTTCACTTCAGCATCCTTCTGGTGGTCTCCGCTATACAAAGCGCCATACAAAACCTCGTTTTG
CGCATTCCGCATTCCGCGCCGCCGCCCGCTGGCCGTCACTTCCCGATTCGGCATGTTCCGCATCCACCGCCGCGCTGCCGCTTCACTCTCCAGTCTCCCG
CGCGCGTCGGCGCTCAGTCATGTGCGCGGCTTCCGCTCCTTCCCGGGCGACAAGCGCGCCGTCTTCCAGCAGAAGGGGCTCTACCGCCAGCTCGAGGAGA
AGGATAGCTGCGGCGTGGGCATGATCGCCAGCCTCAAGAAGCAGCCGTCGCGCGCCACCGTCGTGCAGGCCAACGAGATGCTCGTGCGCATGTCGCACCG
CGGCGGCTGCGGCTGCGACCCCGCGTCCGGAGACGGCGCCGGCATGCTAGTGGCGCTCCCCCACGAGTTCATCGCGCGAGTGGCCGCGGACGGCGAGTTC
GGCGCCGCCGCCAAGCAGCTGAGCCTCGAGAAGGAGAAGTACGCGGTGGGCAACGTCTTCTTCAACAAGAGTGCG