Description :
From Genome Similarity Track
Location :
Scaffold_949:6388- 7501
Sequence
1113 bases(100 bases per row)
TGAAGAAGACCAGGATTGGGTCTTGCTCTAGCAGACGGAAGAGCTCAGTGCGCGCCACGACGTACCGTACCTCCTTGACGGTGTACTGACGTCCCGTGTC
CTTGCCTTGCGGCTTGGCCAGCGATTCCTCCGCCGAGTCCGGCGCGCGCAGCTTCTTCTTCTTCCTCTTGGGCGACTTGCGCTTCGTGGCTGCCGTGGCG
GTGGGTTGTTGTTGGTCGTCGGCCTTTGCAGGCTTCCGACCGGTAGGACCGCGACTTGTGTCACGGCCCTTCGCGGCTCCCTCATCGGGAGCCGCATCGG
GAACGGCAAACTGTTCTTTGTAGCCCTCCTGGTCGTCGCTGGCCCCGTGGCCTGTCGTGAAGGTTCCCTCAGAGCTCCACGACGCGACAGGCCTCTCACT
GTGCTCTCTTATAGTCGGCGACCTTCCAGCCGACTGCGCACCTGCCTCCGATGCCTCTTGGATCGTTAGTCCGTCATTCGAAGTAGTACTCCCGGGTCGC
GGCGCCATTGTGGAGTAGCGCCCTCGCAGAAATCTCGCGAATGCGGTCTCGCACAAACTCGGTTCGTCTGGATAGCGGTCGCGCCGAGCGAATTATTCCC
GGTTGTTGGAGTAGCGTATCTTCGAAATATAGGCCCAAGTCTTCGCAGGCTTCAGAGTTGGGGGGGGTCTTGTGTTAACGCTTGTTCCTTGTCGTAGGGC
GTCGAGCCTTGGGCGTGCGGCGTTATCGGGCCGGCTTTTCCTCGGCGTTCCCGTCGGGCGTGCGGCGTTATCAGGCCGGCGTTTCCTGGGGCTTGTGTGG
CGTTATCGGGCCTACACGGGGAGTCTTGTGCACGGCGGTTATCAGGCCAGTGAGGTCCTTCCCCTAGGCAGCGCGTTATCGGGCGCCCACCTAAACGGTA
TACGTTGAACTGCGTCGCGCCCATCAATCCGCGTCGCGTTCCATCAACCGCGTCGAGGTCCATCACTCGCGTCCCGGCGCCTTCGTCCTCCGGCGCCCGG
CGCACCCACTTCTTCCGCGGGGTACTACACCATATTATTAGTATCGGTTCATTGTGGACCTGGTGTGCGGGTAGTCCCAGCCACCTTGACGTGCAATCTG
AGTGTGTGGCGGC