Description :
From Genome Similarity Track
Location :
Scaffold_1376:6388- 7455
Transcript NameFunction/comments
Phypl_g13254hypothetical protein

Sequence
1067 bases(100 bases per row)
CTTTGCAAGTTCTTCCAATATAAATATGTTAGCAAAGACAATAGTGGCTTCGCAAAAGGGAGGATGACTTGACAGCGAAACATCTCGAATATctgccagc
ttgagcagcactTTACAAAGTCGTGGGTGGTGCGTGAGCTGTTGTTGTATACAGCTCTCTCCAAATGCGTCAAGATCCCGTCGAAGCTCGATGCCAACGC
ACGTTCTAACTTCCGTCGTAAGCGCAACTTGGTCGAGAATGTTTCCCACGCCGGCTCCGACGTCGAGGAAAACGCCCGCTTCTCCGAGCGGCCCAACGGC
TTCAAGTATCTACGAGACGCCCGATGGTAACACTTCACCAGCATTAGCATACGTATGGCCGGCTTGCTGACGATCATCGTTCGCGGTGATACCTTCAAAA
ATGGAAGCTACAGCTTCCACCGCTTGCCCTGAGTTGAGACTATATCTGCGTACAACTGCACCTACACAATCAACAACCGCAAGATTAGAAACAGCTTCAC
CGTTAGCAGCAAAATCTGCACGCCGCAtctgctgcgctggcggcactTTCAACTCCTTCGTCGTTGTTGCCTTGCCTGGAACCTTGCCCTCGACGATCAC
CGGCGGCTGcctggccagcagcagcaccgccatcgccaaTAGtttcgtcgtcctcctgtGCAAGTCACAATTGCTGGACGTTCTCAGCGGCCGTTTTGCC
CACCTCGGGCTCTCTCGCCCGCACTATGGCCTTGGACGTTCGACCGAGGCGGGTGGAATCAATCGGGTTAGTCGCAGAAAAAACGCGGGGTGGTGGCGGC
AGTAGCGTTGGCGCGCTTAAAAGCCACCTCGAAGTCAGATCACTAAAAGGCAAGGCAGGAAACCGCTAATCGACTTCCCGTACGTCCTCTTGAGGTTGGC
aaggcggagacggagctcTCGCGTAGCGCGCTTGGTCTTCATCCGACGGGCCACATAGTCTCAGGTGATGCGCAGGACCTCTCTCTCTGGAACTGAAAGG
CGATCTGCGCCAGCAGATTGTCTTCCGAGTCAGTGAAACTTGTGCGCATTTCTGTTGATTTTGGTAT