Description :
From Genome Similarity Track
Location :
Scaffold_3:638663- 640400
Transcript NameFunction/comments
g18890.t1hypothetical protein

Sequence
1737 bases(100 bases per row)
TTACGCTGACGCTTGGTTGCTTTGCGCAGGCGTGCGAGCGAGTGGCTTTTGATAGGCCTTCTACAGCCACGTTCGAGATCACACTGCGCTCGTTCCCTAC
ATTCCCCATCATGAACAATCTGTACTATCACGATGGCAACCCACCGGCGTCCGAGTTCTGGTGCGATGCAGCCAGTGCTCAGCTCTCGTCTCCGTCCGGG
TCGGTGCAATGCGTGTTTGAAGATGTTTCCGATGCCAATGTGAAGTCCTACGAAGAATGCAGTGGGCACGGTGACTGCAACTCAGCAACCGGAATCTGCG
CTTGTAACGAGGGATTTTATGGCGACCACTGTGGTAACAACCGCGATGATGAAGATATACTGAATGCACCAGCGCGAGGGCCGTTCTTCAAGGGCAACGT
ACTGCACCTATCAGCGACGCGTGGGCTGTCCTCCGATTTTCAGCTTGTGCGTGCCGACGTAGGTGGGCAAGCGTTGTTTACAATGAATGGCCGTGGAGAC
ACAACTTGGCACCACGGGTCGCTGAAACTGCGCGATGGAGGTTTGTACATGAGTGGTGGTAGTGCCTTGCAGCTGCAAAAAGATAGCACATTCGAGATGA
AAGATGGACGTGCACGATTGCAAGATTCACCACTTCATTTACAGCTTCAAACCGCCACCGACTCCTCCACCAGCGGTGCCGCGCTACTCAACATCGAGAG
ACTTACTGCGGCGTCGACAGCGGAGCTCTCAATGTTGCCAGATTTTTTCCGTATCACGCAACCCAAAGGCCCCATCTTGCGAGTTAGCGGTGCAGGACAA
ACAGTCATCCACGGTGGTGGTCTGGAGATTTTAAAAGGTGGTCTCAGACTCGAGCGTGGTGGAATCCAGGTGCTTTCGGATGGAGTGAAAGTCATGAGTG
GAGGTTTAGAGGTGCAGAATGGCAACCTGGCTGTACGCTCCGGCACACTGAGTCTGAAGAATGGCCAGACAACTCTTGCTGCTCCTGCTGGTCCTGTACT
ATTACTGCAGCGCGATAACATTGATGGAGCGTCTCCTTCTAGCCCACTGATACAGGCTAAAGGCAGTAGAAGCAGCGACAGTACGGTATTTGAAGTGCTT
GATTCGGGCTCCACTGTGGTGCACGGTGGTGGAGTGCACGTGCTTGCAGGTGGCGTGACCATTGAGTCTGGCGGTCAAACAATCACATCCGGCGGCTTAC
GTGTGGAGTCTGGCGGCATTCATGTCGAGTCTGGAAGCCTCACCACCCGAGATGGTTTTGCCATAGACGATGGTGGACTGACAGTTCAAACAGATCAAGT
GAACGGGAAAGCGCTGCGAGTGGCTTCTACCAACGCTAATTTTGCAGGAGCATTGTTGAACTTTGATCTCTCTGGCCAGCATCGAGACGCGCCACCTTTT
CGTGTTCTCGAGGTCTTAAAATCTTCTGAGCCTGGTAGCGATGCGACTCAAACAGAAGACGTGGTTTCGGTAGACTCGCTAGGTAACTTGGACACACGTG
GAGATATCACTACTACACATGGTGGGCGAATCATTGCCAGTGGCGCACTAGTCTCGCAAGGACAGGCGGTGTTCTCGAACGTACAGCTTCGCGCGTCTGA
AAACCTGGTTATTCCGAGCTCGAACAGCTACGTTCAGGTCACCAGTGACGGAGTAGTATCTCCGAACCATGCCCGAATCGACCTTGAGCACGCATACGCC
GGTCAACTTCTTGTGATCCAGAACGACGACGAGCAAC