Description :
From Genome Similarity Track
Location :
Scaffold_5:638640- 641385
Transcript NameFunction/comments
Phyci_300233Hypothetical protein
Phyci_209635Hypothetical protein

Sequence
2745 bases(100 bases per row)
CTGAGGCTGAGCAGGAAGCCAAGAAGCAGCGCCAGGCAGATGCTGCGGCCAACAAGGGCGCGTCTAGTTACCAGGCTGCCTGGCTCGACGGTgaagagga
ggaggagggggagggaatgaaggatgacgatgaggacgaTGCGGGTGCGGTCAACCAGGACTTCTGCAAGACtggcgaggatgaagatgatgacgatgat
gacgacatgttcatggtcgatgacgactacgttgatCAGGCTCAAAAACGCAAGGACGAAGAGGAAAACATGTCGTTCCCTGACGAAGTGGACGTGCCCG
TTGACCAGCCTGCTCGCGTGCGTTTCGCTCGCTACCGTGGAATGAAGTCGCTACGCACGAGTGCTTGGGACCCGAAGGAATCGCTTCCTGCTGACTACGC
TCGCCTTTTCCAGTTTGCGGATTTCGCCATGGTGCAGCGACTTGCTCTTGCTCGTGGTAAGGATGCCGAGCGTGCCATGAAGGAGCAGCTTCGCCGCAAA
TCCAAGACACAGCAGTCTCGCTCTCGTGCTTCGTCCATGGCCATGGAGGATGTGGAAGACTCTGCTTCCGTCGCTTCTTCTTCTCTGGCCAGCGAGGCGC
TGCCCGACGAGTTCGGCGAAATGGGCTATGTGCCGTCCGGTGTGTTTGTGACGTTGCATCTCAAGAGCGTGCCCGTGGCTAAGCTGCAGGCTCGCATTCA
GGCTGGTCCTCTTGTTATGGGCGCTCTGCTTAAGCACGAGAACCGATTGAGTGTGCTCAACTTCTCCGTGCAGCGCGCTGCATCTTTCGCTGGCGAGACG
CTCAAGTCCAAGGAGGAGCTTTCTTTCCACTGCGGCTTCCGTCGCTTCTCCGGCAAGCCCGTTTTCAGCGACCAGAGCCTGAAAAGCGACCAGCATCTCT
TCCAGCGATTCCTGCCGCAGAGTGGTTGGAGCGTGGCAACAGTGTACGGCCCTGTCACGTTCCAGCCTGCTTCCCTGCTGCTCTTCAAGCCTGATGGCCA
GCTTGTTGCATCCGGTACGCTGAAGAATGTCAACCCAGACCGCGTCGTGCTCAAGCGCGTCATTGTCACGGGCACGCCGGTTAAGGTGAAGAAGCGCAAG
GCTGTTGTGCGCTACATGTTCCACTCGCCGGAGGACATCCGGTGGTTCAAGCCCGTGGAGCTTGTGACCAAACACGGCTTGACAGGACACATCAAGGAGT
CTCTGGGTACGCACGGCGACCTGAAGGCCGTGTTCAACAAGCCCATCAAGCAGCACGACACCGTGTGCCTCCACCTATATAAGCGCGTCTACCCCAAGTT
CCCGACGCAAAACCCTCTGTCGAACTAGATCAACAGAGTAGCTTTGCGCCATTAGTTTTGTTCATATGCATTATTCGAACACGAGCAAGCCTTCTTGGCG
TTTTACTACAAGCTGCATTGTGTAGATAAGTCCTAGCCTACTATCAATTCAAAGACACTAACACGCAAGTAAAGCGTCGTTCGCTACCGCTAGCTGCATC
GACGTCCTACTCACGTCGTCGCTTAGCCGCCGGCGAGTCGGTAGCCACGATCTCGCTGTCGCCCTCCTCGCGTTGACGAGTTCGTCCGCGACGGGCGGTA
TCGCTATCTCCTTCAGTCCAGCATAGCAAACTGTCAACGGCAAAGCTCGCCACGTGTTCGTGCATGCCCAGCCACAAAAGTAGCCCTCGCAACAAACGCT
TCACCCGCTCGTCGCTTTCGTCTTCGGACTCTGTCGAGTCGCCTCGTGCGTAGGAGCGCATCTGGCGAATAACCTGCTGAGCCATCGTGCGCAAGAAAGT
TGCGCTGCTCGCACCAAACGCAGCGGCTCGACTAGCAGATGTAGCGCGAACAAGGGAGTCAACGAGATCTGGCACGAACGGCTCCACTACACGAAGCAGC
TCGTCTCCCAGCGCCGATCGCCGTTCAACGGGCCCATCTACTTGGTCAACCACGTCGGCAGGCAGCGCGTGCACCCGCAATAAGCGACGGAGTTCACCCA
CCAAATCCTGCGCCCACGTGCGGATGCTGGGTCTGGTCACTCGCGGTACATCAACCCCACTGAACAGCGCAAAACCAATGTGTGCCAGGATCTGGTGCAG
TTGGGTAGCATCACCAGCAATAACTCCATACAGATTCGCGATCGGCAACTCACTCGTCAGCCGACTCACAAAATCTGCTAGATTCCAAGTTGTTGTCGCA
TGGTTGCCACCGAGACCCGCTGCAAGAGAAAAAGGGAACACTACCGATGACATGAGCGGCAGACCCATTCCAGAGATCGAGATGTGCGCGCCAGTTGGCG
GCAGTGGGCCGTTCACGTCGTCTGAGACTCCACCAGCGCGTTGACCTTGGCTACCTGGTTGGCTATTCCGCGTAGATATTGCTGGTTCAACAGGAGGTGG
CGGAGCTATGGCACTACCAGGACCCGTGAGGTCAACCGAAAAACTGTGAGACGATCCTGGAGTAGTGCTGGCAGTGTCCGGGGCTGTGGTGCTCGGGGCT
GCAGCGTTTCTTTCGCCCGTCAGATCGGTAGCACTGATGCGAGCCACTCTAAATCGCGGTCTAGCGTCACCTTGCGCTGTTGTTCTCCCTGGAGTTGCTC
CTTGTAGTGAACCGAGTGTCGCCCGAAACATTCTGTCACCTACTCCTTCTCGCGCAGCTCTAGCTGTCCTTGTTGCAGCTTGCAACGCCTGAAGTGTCGC
CTGCATTCTATCACCTGCATTTGTCGCCTCTCCACGTCTAGGAAT