Description :
From Genome Similarity Track
Location :
Scaffold_43:6386- 11208
Transcript NameFunction/comments
Phymu_g2374hypothetical protein
Phymu_g2375hypothetical protein

Sequence
4822 bases(100 bases per row)
catgcaaatgcagcagcaacagtaccagcaacagcagcagttccagcagacTACAGGccccaacagctccaactgGATGAATAACTTCGGTGGTGGTAAC
CAGACCTCTGCAACCACGAACGCGCCGGCTTCTGGCAAACCCAGCAACCCGTCCGCTCACCGTCAGCTCTCGAACCCTACAAACGCGTCGACTTTGGATA
TCGCCGTGGCGGAGGGGGCTGCTTCCCTCGTTGCGACGTGTCCGGCGTCTAGAGCCCCAGCGACACCGACTGCGTCCTCGTCACTTGCGTCCAACGCGCC
TTCTGGCCCTCAGCACGCTAACAACTCAAAGGAGAACTCTAGAGCACAAGTCGACGCTTCTAGTAGCACTAACAAGACTAACAGCACAGACACAGCTCCA
GGCAACAACGACGCCAACATGAGCGACCCGTCGCAACAAGCCAACGCCTTCGGGCAGCAAGGAATGATGATGAATCCCTTCTTGATGTACTCGATGATGG
GCGCCCAGGGGATGAACATGATGGGGATGCCGATGCAGATGCCCATGGGGATGAACGCGATGAACACTGCCAACGGGATGAATAGTGCAGGGAATGGAGC
GGGCAATATGAACGGGATGAACGGAATGAATGGGATGTCCCTCCcgatgcagatgcagttgcagttgcagcttcaGATGCAGATGGCTCAGATGGCGCAA
ATGAACGGAATGGGAATGAATGGGATGCAGATGCCCATGGGGCTTCCTGGTATGCCCATGGGCATGAACATGCAGATGCCTCTGAATATGAATATGCAGC
AACCAGTCAACCCGCAGAGTGGACAGGCAGGTGACGTTGAGATGGCGTCAGCTTTCCCCACGGGAGCGCCTCCCACTGGCAGTCAAGCGCTGAAACCTGC
TAGACCTTTGCAGCCGAAGGGAGTTCATGGAGGACCAGGTTTTGTGAATATCGCGCGGAAACCGGAAGAGCCTGAAGTGAGTAGCATTCTCAAGTCTCTc
atggacgaagaagccaagaagaaagagaagaaactcgaGCGCAACCGAGACTCCGCCCGAGAGAGtcggaagaagcagcagacgtaCGTGGAAACGCTGG
AAAACGGCATCAAGCGCCTGCAGATCAACCGCGACCTCGTTCGTTCGTACCGATGGGGTGTCAGTGGTCCGGGCTTCGGTCCCCTGCCGTGCCCGAACTC
TCCGCAAATGTTTGACTGGAAGAACCGCGTCGAGGTTGTAACCGGGCGAACGGAGGCTTTTTCAAGCATCCAGAACCCCGCGAACTTCCAAGCGCTCATG
CGACTCAACCGACAGCGCCGCACGCTCGCCATGCAGCacgaggagcgcgagcacGCCGTGTGGAAGTGCTTCGTTTTTGTGGGGCGGCAACTCGCTTTCA
TGCGCTCTCGTGTGCTTCAAGTGCAGATGCTGCGGATGTTCTCACAGAACCCGTTGgcaatggagctggacgcggAGTTGAAGCTCTCAGCggaccagaa
gctgcagctgcagtgccaCGCCCAGCAAATGTTCAACGagcaggtggtggagctcacgaagctgttcaagatcttcttcgcgctcCGTAACGAGGCTCTG
CGACTCAACATGTTGTCGCCCACGCTGGAACGCTACTTCCGCGACGCGTGCTCGTTCGAccagctgcagaagctgctgcagtggacgGAGACTCATCGCA
CCGTTATCGAGACGGATCTCCCCCTAGATGAAGTGTAGGAGCGATCGAATAGTTGTGAAATTAACCCCCAGCACAAGTGGAGCGACAGTATTGTAAGGCC
CCAAGCGCAGCGTAGCGTAGACGATTTTGTGGACGTCAAGAATCGTTTGTGGATTAAACTTCCTGCCAAACAAACCCTACTTTAACCTAGATCAATGGTA
GTCCAGGTTGCCTTAACAACTCGCTTTATATATTTCCCTTGTGTCTGCTTACATTCACGCTTTGTCCGTGAGCTCGTGCTCAATTTGATGCAGTTCCTGT
AGTAATTCGTCGGCTGTTGGTCGAATCTCTGGCTGGAAGGCTTGGCATCTGAACGTCAGCAGTCGAATTGGTGTCGGCGCCTCGCTATCTCCGGGTGAAT
TGTCCTTGTCGGTGTTATTCAGCATGGGGACTTCAGTGTCGTCCATTACCGAATGCTCAGGCGAAGAGCACTCGTACGTTGCCAGTTGAGAGAGCAGCAC
TCCGAACGAGTAAATATCCGCTTTCTGCGTATACTGGCGGCCGTCGAGCACTTCTGGAGCTGTCCAGATCGTCATATCCATCGGGATTTCCTCTCCTTGT
TgggagctgcagttgctaCGGCCAGAAAACCTCGCGGATCCAGTGGAACGAGCTTCGCTGTGCTTGTGGGAGGACGACCAACGTCGGAGAGCACTGCAAC
AAGTCAAGTCTCCAACTTTCACGGTCCAATCGCTGTCCAGGAAAACCTTCCGAGAGCTGAGGTTGCCATGGAAAAGCGGTTGCGAGAACGAGTGCAGATA
CTGCAGAGCCTGAACAACCTCAATGGCGATAGACAGCTTGCTCTTGTATACAGGGGAAGACCggcgccagctccacttgCCTGCATCGTTAGAGAGCTCA
ATCTCTCCATCCGATTGAAGGAGAtcctcgtcgtagtcgtcctGATAGGGTGCTGTTGCTCGGCAATCGACTAGAGTgtgcttgtggtgctggatgaacg
AGTTCAAGTCCCCCTTGTTCATGAATTCCATCACGAGAGCAACTCCCTCGCCCTCGATCTGCTCAGCCACGCGTGTCATCTGGACGAAGCCATAGAAAAC
AACGATCTGCGGATGCGACAGTGTCGAGCTCAGGCGAATTTCCTCCACAAAACCCCATAACTCTCCGTGACCCTCGCGATGATCAATGATAGTGCGTGTT
TTCAACACGACCGGCTTGCGGTGGAATGTAGCTTTGAAGTAGACGAAAGGTGACGAGCTTTCTCCATTCCCTTCCGAGGCGTTCTGGTCGAGCATTGTAG
ATGGGAGAAGTTCTCTGTTCGTAAGAAGAGATTCGCCCATTTCCCAGtgtggaagctcttgacggAGGTGGCCAATTGGATCTCTTGCGTCTCTTTCCTC
GACCTCAGGTTCAGGCTGAGACGAATCTCCGTCCGTAGTTGACAGTAATTGGCGAACCTCGTCATCCTGTTCCATACTCGCGCTTTCCTTCCAGAAGTTG
TTGGGTCTGGAGGTTCCTGCTTTTGCCAAAGTCGGTTTATTCTCTTTTCCTGTCGAGACGCCGCGAACTTTACGCCCCAGACACAAGCAAAGGCCGTTGA
CGAACAACAGAACCGTGAAAGCCGCcagtaaagctgctgctccgatGAGAAACCACGAGCGTCTCTGGTCCATCGTTTCCTTCAACGCAATCCGCTCCGC
TTCTTGACTGGGAGAGGCGTCAGTTCCCCACATGGAGCTTGACATGGACCCGCTGGATGCTGCGATCACCACACTCTCGTACTTGCTAGCGAAGTCGCTA
TCCGACAGCACACACAGCATCGTGTCCTGCACGTAGCGAGGGTTCGCGTTGGAGTCGGAGCAACTGAGCGTTGACGTTGTGGAAACGTCCCACAGCGCCA
ACTTCTCAAACCTTTCAGCATCGCTTTGACGCACCTCGAACTCCTTTAGGACGCTGACTGCTGGTTCTTTAGCGTTTTCAACTGTGGTTTGTAGCTTGCG
GCCTTCGTCCGGGGTAACAACTGACTCTGTTGTCCTTGTGGCCACGTCGGAGGTGGCGAGGAGAGTGAAATCCGTGAGAGAATCCGGGAAAATGACGCCG
TTGATCATCGTGATGGGGTTGCGCGAGAAGTTTAGCGTCGTGATGGAGCTCGGAAAGGAAAACTTTTCCAAGGAAGCGACACTGGCATCGTTCACATCCC
tacgcagcaccagcaaatGAGAACTCTGAGTCCAAAGCTTTTCAGTAAGAAGCAAATACTTTTGTACTTACAGGCGCAGTAAGCTGGACGGGAAGGATAC
ATTCGACAGAGAACCGATGGGGTTGCCGGACAAATTGCTGCGCCATAGAAAGAGTAAGCGTTAGAGAATGATAGCAATCACTGACAAGGAATAACGTACA
GATACTGCAGTGATGACGGGAGTGAAGCGCCGTCAATATCCCCTAGAGCGTTATCCGAGAGATCCCTGACCACAATGGCAATACCTTTAATAAAACAAGA
CACAAGACCTTGTCATGAGTCTCAACGTACAAAAGTGTGAGTGTTGTGGGGAACTTGAACTCGTCTATCGTAGGAATGCTGTTGTTGGACAGGTATCTGC
CAAGCAGAGCAAAAAAAACACCACAATAAGCGCACGAACTCTATGTCCAACCATGAAACTCGGCACTTACAGCTCCGAAATGTTGTTGCTCGTAGTGAAG
GCGCGCAGTTCATTGTTGTCCAGCCGTCTACTCGCATAAAAAACATCAGTAAACCCCTGTATCCCAGTTTATCGACCTTTTCCCGCCTTACACAGTGTTG
ACCGCCGGTAGACTCGCAATTGCTGCGATATCTCGGTGTCGAAGGTCCAATGTGCCCACCCCTGAGGTTGTAGCGACCTCCACGACACTGGACGTGCAGG
ACGCGTCTGTGACTTGGACTCGAttgctggacgtggacgtcttGGAGGCATTGGACGAGCTCCCGTAGACGGAGACCGTCGTGACATTCGGACAGGACGA
GGCCCCATTCCCCTCCGTTTCTCCCACGTCCACTGCCACGCACGAGTGACAGACCGTCAGTATCAACAGGAATAGAGCACAGTCCAGTGTCATTATGGAA
GAGCTCAAGTGCAAGTATTCAG