Description :
From Genome Similarity Track
Location :
scaffold_6:638598- 641866
Transcript NameFunction/comments
Plaha_PHALS_07667hypothetical protein F442_13671%2C partial
Plaha_PHALS_15246hypothetical protein

Sequence
3268 bases(100 bases per row)
CACGATTACTACAAATAGTTGATGAAGTATGTCGTGAACGTGAGTGTCATTTGATTTTAACTGGAACTTCAGCATTTTCGACATCTTCGACTTGTCGAGC
GACTACTACGCATCTTGAGACTGGAAATGAACAACAAGATATTATGTTATTACCTACAACGGGTGAAATACGAATGGAAGGATGGCTACGTAAAAAGGGA
CAACATGTGAATTTATGGCGAGAACGATATTTTATGATCCGTTCAACACCTGATGGTACACATTTTTTATGTTACTTGAGAAAGAAAGGAGATAAAGAGC
CACGTGGATGGTACGTTCTTGGACCAGGTACAACAGTTGATGAAGTAAGAGAGTCACCTAGTAAAATTGAGACTAAAAAGCTTTTTACGTTTCGAATACG
ACACTTGAGTCATACACCAAATGATGAAGTTGATGAGAGTGCAAATGGAGCAGAAATGACACCGAAAACGACACCATCACGATTAATAACCGAGTTACCA
TACTCTCCGCTCGATTCAGCTGCTGTTTTACATGATATGGATCCTGACTTGAAAGTGAACGTCAAGCGCGTGTCGTCTCGTAAATTTCGAAACCGagcag
ctgctgctgctgctgctgcaactgcagcaactgctgtaGTATTAACTGGTGGTCTTGCTGGTGTTGGAATTGGTGTCATGGGTATGAGTATGAGtgcagc
agctgctgctAGTGCTGGTGCTGCAGGTGCTATGATAGCTCAAAGTCGCAGTAAAGGTCCTATTGCATTAGCTGCTGAGTCATTGGAGACGGCCATTTGG
TGGCGCAATAGCATTTTAGAATGTATAGCTCAAGCAGAAGATCAGTGGAAACGCTATTTAAATTGGTATATGAATCAAGATCCAGATATGGATGACACAA
GCTTGAATCCATTATTGGACTGCAGATTGCCCATTACTACGCTCAATGGCATTTCTAGACGACGATCAATGTCGTTGCAACCGTTTGGTAGTGCTGGAAA
TCTTTCGCTTCATACAACTAATCGACATCGCTCGGGCTCATTTGGATCCATGCCACGATCAATTGCCAAGAGTTTTCGTACTTCAGCCACCTTTTCACAG
GAGACAAGTTGGAAATTATACGAGTTTTCCAATAAATTACGCGTCGATACTGAACGAATAAGTTATCAGAATAGTCTGTTTACGTTTGCTCCACCACCAG
CATTACGTACAAGCTTAAAGGTTCATGCATCTCCTCGTAAGGTGTTTGAGATGCTTATGAAGGTAGATAGTTCGTTCTACAAATCAAATCATGTGATTCA
AGAAGCACGTGTTTTGGAAGAGCACACAAAAGATCATAGTGACGTGGTCTACTGGAAGCTTTTCCCCACGTATCTCTGGCCATTTTACGTGAGTGCTCGA
GAGCTGTGTATGCTCCGTTACTGGCGCATGGAACCAGATGGTTCATACTTTATTTGTTTTCAGTCTACAACACATAGGAACTGTCCTCGTAAGACTGGAA
CTGTGCGTGCTAGTATCATGGGTGGTGGTTTTATTATCTCACCTCGTGTACAAGAAGACTATGATCACCATTTTGAAGAGTGTTGGGTGACACTAACAAT
ACAAATGAATCCACACGGATGGATTGACTCCAAGCTAGCGCGTTCATGGTATTACGTTCATGCTTATGGCGTCTTTGTTTTGGAGATGATTACAGCAATC
ACTGCAACTGCAGGTCTCCACACTCTCCGTCCAGGTACAGTCACTTCAACCTGTCAAACAAGTCTGGATAGTCAATTAGCCTCCATAAATCAGCACAAAA
GCATAGAAAAACAATATCTGATGCTCGAAAGGTATCGTACCGATCTCACAGTGCAGCATGGATTGCCAACTAAATTTTGGAGTGAGCCGAATGCTAGTAG
TTTTGTTGTCCGTGGACCAAACTACTTTTCGTCTAAGAACAAGGTCCCGTCAGTACGTCAGGCATGTCGACTCGTAAGCGTGGAACTATACaagtcaaat
gaaatgattcaACACATTGGCGTGTCTTCTTTTGTCGGAGATGGATTTGATACTATTGATGCGCCAACTTCAGCAATAGAAGATCGTCCATTTATCTTAA
TCATCAACTTTATGCTTCCCGGTCCACTACATCACTCGCTCGTGCTCTATTTTACACCTGAAGACCCGTCCGAAATGAAAAAGAATTCTGTCTTTGCTGA
TCTTTGCCATCAAGTTCTACGTGGTTCGAACGATGAATTTCGTACACAGCGTATTAAACTTATACCACGTGTGGTGCAAGGCTCGTGGCCGATTCGTGAA
GGAGTGGGCACAACACCCGCTATTTTAGGTACAAAGATCTATCAGAAATATTATCAGGGCAAGAATTATCTTGAGGTGGATTACGATGTTGGTAGCAGTA
CAGTAGCTACAAGCGTCTTGAATCTCCTGATCGGGCATTCTCGGGACTTAATCATTGACTTGGCTTTTGTAATTGAGGCACAAAGCGTCATGGAATTACC
TGAACGTGTATTATGTACTGTACGTTTAGATTGCATTGACTTGCGTCATGCTGTGCCATACGCGATGTCAAGATACCTGGCCacgaaaaattaaaaatgt
cATTGGACTTTCGCTAAAAAACTTGATAATGAAAGTCTTGCAGCAGATCATACTCGACAAGCGTTGCTGGTCAAATCTTGTTGAAAGAATCAGCTACGTA
GTAAACAAAAGCATGAATTATTCTTGGACAAGCACGTGTGTACTGCGTTTGGGAATTCTCGTATGTGTTCACTTAAGTCACGTGACAGATCAAGGTTATC
GACAGCAACTCTTGAGTTTTATTTTGTTTTAGCAGTATGATGACGAGACATCACAAGCTTGATAAGCCACAGCCGCGATTCTATGGAATTTATGAACGTA
ATATTCAGTCTCACTCACTGACGCTGTACTGAGAGGCACCTAGTATTTGGATTGCACAAAGCGTGATTTTGTGACGTGACAGAATAGATTTAGATTCGTC
ACCAGTAATGGACCGAGAGAAATCGATTTGATATGTTAAATTGACAGTTCAATTGAACGATACTGACGGTAGCATTGATGTCATGATGAGAAGTTGTAGT
CTATAGCAATTTGATATATCAAATTAATGCACTTTCAATTTCCTTCTCTGCTATCTTACCCGAAGTCCCTCAATGTCATGCCTCTAATTTGATATTGCAG
CTTTCTCATCAGtcgaaaaaatatttaaacTTATTCACCACTTGCATTAAATTTAAGAGCCGTGTGAC