Description :
From Genome Similarity Track
Location :
contig_29:638583- 641471
Transcript NameFunction/comments
g5865.t1hypothetical protein PHYSODRAFT_253204

Sequence
2888 bases(100 bases per row)
TGCAACAATAAGGTGATAACGGCCAAGTACACCAAGCTCAACTTCATCCCGCGGTTTTTCTACGGGCGGCTCTCGCAGGTGGCCAACTTCTACTTCTTGC
TGGTCGGTGCAGGCCAGATTATCCCCGAGATCTCGTCAACGCAGACGATCCCATACCAGTGGATCGTTTTGATGCTCGTCTTGTCGATTGATGCCATCTT
CGCCGCTATCGAAGACCGCGGTCGGCATGTAGCGGACGGCAAAATGAATGCTCGTGTCTCGCACATTTTCGATTTGGACGAACCCGATTGCTTTCGTGAC
GATACCTGGCGGAACGTCGCGGTGGGGAACATCATCAAGATCGAGAACTACGAGGCGATTCCAGCGGATGTGCTCTTGCTAGCGGTTTCTGAGCCGGACT
CGAATGCCCCCACGGGTATTTGCTTTGTAGAGACGAAATCGCTTGACGGTGAGACGAATCTCAAGGTCCGACAAGCACTAAGCTGTACGTTTTCGCAGCT
CAGCGACCCTCGCGCGCTCGCCCAGCTTCCTGGCCGTGTGATTTGCGAAAAGCCCAACCACGATGTCAATACCTTCTCCGGACGCTTTGAACCGCACAGT
GGACATGCAATCCCGATCGACCTGAAGAACGTGGCGCTACGTGGTTGTGTAATTCGAAACACAGCATTCGTTTATGGACTTGTCCTGAATACGGGCGGCG
ATACCAAGATCATGCAGGCCGGGTCACACACTCCTCCCACCAAGATCAGCAAGATCATTGCCATCGTAAACCGCGGCAACGCCTTGCTCATGGCAATCCT
CGGTTCTTTGTGCATTCTTGGTGCTGTGCTGTGCGCATTCTGGGTTGCGGAAAATCGCGAAGGCGCCACGTACTTGCACCTCGAGAACCTAAGCGGCGTA
GCTCCTTTCCGCAACGACGTTGTGGGTGTGTTGATTTATCTGGGCTACTACTGGATCCTGGTCGCCTCGTTCGTTCCCATTACGCTGTATGTGACCATCG
CCATTGTCAAGACGTACCAAACGTTTTCTTGAATCGCGATCTCGGAATGTACGACGAAGTTACCGACACACCGGCATTGGTGCGTAACTCGGATCTGAAC
GATGACCTTGGCCAAGTGACGCACATTTTCAGCGACAAGACCGGCACGCTCACAGCTAACGAGATGGACTTCCGCAAGATGAGCATTCATGGCGTGTCTT
ACGGACGAGGCACCACAGAAATTGGCCGAGAGGCTACGCGGCGCCTTGGTAAGGATTTGTCTGCCAGTGATGTGCTAGCGGACAATACTCCAATTCTTGA
GAAGACGAACAATGTAAACTTCCTGGACCCGGCCGGAGATTTGGAGCGAGACAGCGACGTACGTCTGCACCCGGAGCAGGCAGCACGCATCCATGACTTC
TTCGTGCACCTGGCAGTCTGCCACTCGGTTGTGCGCGAGACGTTGGCAGAAAATGACACGGGTACAGGCTTCTCGGCTTCGTCCCAGACGAGCTCGCACT
CGTGTCTGGCGCCAATTACTTTGGCTATTCGTTCCGTGCTCGTCGGAACGGTGAAGTGGCCATCGTAGTCCCTGGAAGACGTGAAGAGGTGAGTTATGAG
CTGCTGGAAATGGTCGACTTCACTAGCACGCGCAAGCGAATGTCTGTGGTCGTGCGAACGCCTGACAAGCGTGTCATGCTGCTCACGAAAGGTGCCGACT
CCGTTATCTTCCCCCGGTTAGCTCAGTCGTCAGATTCATCGATTGTAGACACGACACTGATGCATCTCGAACGCTATGCAACCGAGGGTCTACGGACACT
TGTGATCGCGCAGAAGGAACTATCCCCGGAAGTGTACGCTGAGTGGTCTTGCGAGTACGATGCAGCATTAGGCGATTTGGAGCAAATGGCAATGCAACGG
CGCGGTGAGCCTAATCGTATCGAGGAGCTTGAGGAGCAGCTGGAGCAAGGATTGCAGCTTATAGGCGCTACGGCTATCGAGGATCGTCTGCAGGACCAGG
TCACGTCCACGCTGGGAGACTTGGCGCGAGCAGGCATCAAAATCTGGGTGCTCACTGGCGACAAGGAGGAGACGGCCGTGAATATCGGCTTTGCATGCCA
GCTACTCGACAATGACATGGAACGCATCATGATTAACGCCGAGACTTTGCCGTCAGCCTCGGATCTCTACGACATGCTGCTGTCTCGCTGTGTTGAAGCT
CGAAAGCGTACGGAGCGACAGGCGAAAGGAGCAAAAGAGGAGTCGCGGCCCCAAGCCATTGTGATTGACGGCCGAAGTTTAACGATGGTTTTCAGCAACA
ACGTGCTCTCGGAGCTGTTCCTTGAGGTCTCCCAGCAGTGCGTCTCCGTCATTTGCTGCCGCGTGTCCCCAAGCAGAAAGCGCAAGTTGTTCGCCTCTTC
AAGTCGAATCTGCACGGTTGCCGCTCGCTCGCCATTGGAGACGGCGCAAACGACGTTGCCATGATCCAAGAAGCGCACATTGGCGTCGGCATTTCGGGAC
ACGAGGGGATGCAGGCGGTGAACGCAAGTGACTTCGCTATCGCTCAGTTCCGTTTCCTGAAGCGCTTGCTACTTGTCCACGGCCACTGGAACTACCGGCG
CATGGCGAAGCTGGCGCTGTATGTAGTGTACAAGAACATTTTGCTGTTCGGTACCGAGTTCGTGCTGGCTGTCCTGCCCCAGTGTGGGTCGTCCGGCACT
CTGTACTTCAACAACATGTGGATCAACGGCTACAACGTCTTCTGGTCCTCGATGCCAATCGGAATTGTGGCAATCACGGAGCAAGAAGTCCCCGCGCGCA
TCGCAGAGCAGTTCCCGGGGCTTTACCATGTCGGCGCGCAGGGCGAGTTGTTCAGCTTTCGTATTTTCGCGCAGTGGGTGGCCGAGGC