Description :
From Genome Similarity Track
Location :
Scaffold_116:63849- 65235
Transcript NameFunction/comments
Phyta_totarag3937hypothetical protein PHYSODRAFT_468706

Sequence
1386 bases(100 bases per row)
TAGAGATAGAGTTTTTGACACTGGGGAGAGTTTTTGACAGACATTTTTGCCAACGTCCTCTTCGGATAGGAAAAATTGACTGGACGCTGCCGTCTGATCA
ACTGACTGCGTGTCGTGCAGCGTGACGCCCATGCCGGCGAGCACCAGgttcttcaccagctccgaGCCGAGCGCTGAGAGTCCGCTGACCAGCACGCGCG
AGTTCTGTAGCCTCTTCTGGGCCTCCACACCCCATAGACGCATCTGTCGGTCGTACACGGCCGCCTCGGCCGCGCtgaacgtcgtcgtcgcctgctCCGC
CATCTCTTCTGGAGAGTTGTAACTTACTTGAAATTGAACGAATATTCATTTTGAATCCATTCAGATTTAGAATATTTAGAAGATCTAAATCTATGTGACT
AATAATCCGGATATTGGTATACAAACTCGATTATCCGGCTTTTACCCAGATTACATGTGTGTTGATTATAACTCCCTGGGGGAAGAATAAGTGTAAACTG
CCTCGTCTCAGTTTTGACTGGCGATTTGTATTGCGACCAGCGACGGAGTTTTGTGTGTGGAGGTGTAGTGTGTGGGGGGCCCCACTGGGGGGGAGAGAGA
GGGAATATGCAGGCCATCAGGACAGAGTGCACAGCTGACGTTGCTTAGGTCCGTCCGCGATGTGCCGCCGCCGCACTTCGCAGAGCTCACTATTAATACG
TTCGAGCTCCACGAGAACACTATCCGGTAGAtcttcaagcgcttcatggAGGGCTTACCATGGAGCGTTCTGGGGCAGCAAACAGATCCCCGGCACGGCC
GATCAAGAGACACGGAGGTCATGCTTTCGAGAGGGAGCCCGGACTTCCTGGCGAAACTACAGCGCCGCATTCGCCTTGCTCAAAGGATGCTTCGGATGAC
GATGTcgtggtcgtgctgctggatcagcACATGCTTCTACTGTACACCCATACTCTCGCCCTCGCATCCTGGACCTGCTGAAAGCGGGCGTCCAGAAATG
AGAAAGCAAGGATTAGCACCAGAAGGTAGATGAAGCAGTCCGTTACCCTCGAAGCACTCTGACACTGGTTAAGAGCACGCAGGTGATCGTGGTTGACGAT
ATATCGGTGAGCTGTACTTTGAACGAGATGGGATACGCTGCCTACTGTGTGGTTGTCTAACATTATTACGGTGCAGTGGCAGACTTCACCAAAGACTACA
ACAGTATCTTCAGAGCAAGCATCCAGCCGGGTCAACGGATCGCCCCATTTTGATTAGAGTTTTTCGAACTGGCCAGGTCACGAGCCACTCGACCAAAGGC
CAAAGCTGGTGAGATTATAACGGCAtactactactgtagtataAACAAAACTCACGAAGGTCTCACCACAGCGTGTGATTGACTAG