Description :
From Genome Similarity Track
Location :
Scaffold_4:638401- 639794
Sequence
1393 bases(100 bases per row)
TTTCCATTAAAGCTCACGGCAATCGACTTAACCAGCACGCGAGTGCAGTTGACCTCCGCTGGCTGAAATCCTGGTTTGAAGAATTTGCTCGCTCTGTCGG
TGATGTGGTACCAGTACGCGTGAGAAAGCAGAAAATTGAGAACGGAGCCGTCAAACTGTACTATTCCGACGCAGAATACACTTTGCTGCCGCCGTATTTC
ACGTGGGATCAACTATACCAAGAGATGCACAACTACGTTGAGCAAATTCGTTTACGCGTGCGGGAGCCTAGACCCAGCACCTTTCGCCAGTACTTGTCCA
AGCTCTGCCCTACCATTCGCATTCGCTCTCCACGCAGCAACGTATGCGATGTGTGCAGCATTTACTGGGCACGCATGCGTAGGGGAGCTACTGCGGCTGA
GACGGAAGAATTCGGAAAGCATACTGCTGCTGCGAGACTGATGAGGTACTGTGGACACTAGAATCATTTTAATTTGCACGTATGTTGAATGGGCGGATAT
TAACGTCATTTTGATTTGTAGGGAAGAATACAAGAAGAATCTTGCGTCGGCAGACGAAGAGCACGCTGTTATCATCATGGACTTCAGTCAAAACCTCACG
CTACCTAGTATCAGCAGCACTCCGTCGCAATGGTACTTCCTGTCGCTGCGAAGTGTGAACATGTTTGGAGTTTACTACGCAACCAAGGCGATGCAGTACA
ATTACGTGTACGACGAGACCGTCGCTGGGAAGGGGACTGACGAAGTGAGCTCAATGCTACACCACTTCATCCGCCGCATCATTCTACCTGCTGGGTTTCG
TCGTCTCACGATCTATGCAGACAATTGTGACGGCCAGAATACGAACAATTACGTCGTACGAATGCTGTTGGCACTGACCCATATGTCCGACCTTGAGGTG
ATTAAGCTGAATTTTTTTGTCAAAGGGCACACTAAGAATGCCGTGGACCGTGGTTTTGGTCATGTGCGGAAGCACTTGGCCCGTTTGGATATCTGGACGA
CGGACCAACTTATTGAAGCGGTCAACGAGGCATCTTCTACGTCTGCTCTAGTGCACATTGAGGCGGAAAATCATTTTTTCAAAGAATATCGAGATGTGGT
CAAGGATGCCTACAAGATTCTTGCCGGTATACAGAAGAATCAGCTATTTGAGATGCGCGAGGACACTCCAGGCGTAGTTGTGTGCAAGGAGGGCCCTGAC
TCTGACGCTGTCGTCCAAGATCTGCGCCGAAAGTATGACGGAATTGTGACGGATGCAACTCGCGTACAAATGCTCTTCACGACTGATCTCGAACCACTGC
CGAAGCCACCGCCAAACTCTGAGAAGATTCAGACCATCTACAACCAGGTGCGTCGCTACGTTCCTGAGGAGTTTGTCAGCGACCCACTGTACG