Description :
From Genome Similarity Track
Location :
Scaffold_948:6384- 8300
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_948-snap-gene-0.3Serine protease family S08A

Sequence
1916 bases(100 bases per row)
CCCAGAGAGTTAGCTGCGATTGTGCGAGCACGGCGTGACTGCGCAATGCGAACGCGAGCACTCGCAGTGTCGAAAAGCCCAGAAGCCGGTNNNNNNNNNN
AGGCCGGCTGCGGCGACACGACCATCAAGCTACAAGGTCGGTGGTCAAGCGACTGTTTCCAGCGATACGTGCGCGTGGAGACTACAACCATGGAGAANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTCAAAGTCGTTCGCCCATCAACCTGCTGCACATAAAGTGATCAACTAATCAAATCTTGC
TGACATGGAGGTGACNNNNNNNNNNCGTGTGATCAAGCAGGCCGCAAACCACGTCGTGGGAGACGGCTCCAGGTATGGCACCCACTCGCTACGCAGCGGT
GGTGCCACGGCCATGTTNNNNNNNNNNTCTTCGCGTAACTGCACAATCCACGCCTTACATTGTGAGGGTGCCCCCACCCCTTGGCTGGATAGGCTCGTGG
CTCACTCCATATGAGTCATACGGTCTGTGTCGCGAGTCTATCCAGAGTGGATGGTTTTCTAGCTACGACTCCTAATCACAGTCGACGATCTAGTTCTGCG
AACCGAACATCATGACCCCAGTCTGACGGCTGTAGTACTGTAGAGTAAACTGACCCTCCTTTCGGAATCAATTATTGATTACTTGAATGACACCATCGTT
GGCCTGTCCTTCAAAGTCGTTCGCCCATCAGCCTGCTGCACATAAAGCGATCAACTAATCAGATCTTGCTGACATGGAGGTGACACCAATCGTAACTCAT
GGGTGATGCGGTGGAACTTGCACCGCGCCAGTGCCGTCCCATCAGCGAACCTGCTTCCATGGAAGCTCCTCCACTGAATACNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACAGGAGTGATACCGAACTG
CCCAAACGTCGGTGAATCGATCTCATTCTCCAATTTGGCGTCTCCAAGACAAACGACCACTCGCACCTACTTTCTCCACTCACAAGCCACTGAATAATGG
TCTCCACCAAATTTACTCAGCTTACGGCGCTCGCCGCACTCCTTGCAGCGCTCTCCGCACCAACTGTCACCGCACGCCCGCGCATCGACCCAGGCGTCCA
TCGTACGCTTCGTCGCCAGGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGACCGAGAAGCTCGCGATCATGTCGTC
CGTCGCTTCGATACGTGAAGAGGGACAACTTGCACTCGCGACGGATCGGTCTCTGGAATCAGCTGTGAGTGCTAGTACGGCGGCCAGTGTCGAGTGGGGN
NNNNNNNNNTCGTTTGAGCTGACCGAAAAGCTCGCGAGCGTGGCGTCTGTCGCTTCGATCCGTGAAGAGGGGCTAGTTACACTCGCGACGGATCGGTCTC
TCGAATCAGCTGGGAA