Description :
From Genome Similarity Track
Location :
Scaffold_18:638388- 642874
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007266Protein of unknown function

Sequence
4486 bases(100 bases per row)
TCTTCGGCTGACGTTGCAACTACACCGAATATGGAGCTTTCAGCCAACATCACGAACGGCACCGCCACCACGGAGTCGATGATCGCCCCGATGGCTGCGT
TTCAAACGTGCAAAGTGATGAACTGGCACAACTGGAACGACTTCAAGTACGCATGCAACTGGAACCACGGCGCTAACGGGAACAACATGTTCTTCATGCG
CTGGGACGGGACGTTCGTCTACGAGTGCCGTTGCGACATGGGCTTGGAAGTTACGACCCATGGGGGTCCCACTGGACGTGGTCCAGACGGACGGCATCGC
GTGCTACACGCGAGACGGCAAGAAATGGTACGAGATTGAGCACCAGTTCGGCTCTGTCACGTGCCGACGCGATCAGAAAAATTGCGACACGAAGAATGGG
TACTGCGCGTCCTTTTAGACGTCGTCCGTCATCGAGCGCGACGGGTGTGATTCTCTGGCATTTAGCTCCATCCCCAGCTCTTCCGCTGACAAGCTCAAGG
CTGAAAGAATCCATTAAATCCAATTTTGCACCACAGTATATCCGAGCAGGTGTATAAAAAAACGTGTTGTCTGGTAAATAACATAACTCGAGTGTTTTGA
ACATGGCTAAGATGTGGATGCCGAGTTTCCGATTTTATATTAGCATGTGAATTTTGAGCCCTGGAGACCTTTCAAGGGAGCCCCGCGTCAGCAGCGCAGG
TCTCTGAGCAAAAGTAAGACAGTGACTGTGTTAGAGAGGCTACGCAAATTGCAAAAGCTAACGGTATTTTAATTCAACTGTGGCATAAGTAGATGGCAGA
GCCATTGTAATTTCTCATGATTTTATGCTAGTACAATTTGCAAAACCTCTATAAGTTATCACCGTGTCAAGGCGAGTCGTGCCGTCAGCAGGATGCTCTG
AATCAGAGCCTCTAATTAAAAAGCTGGGAGATGTGCTGAAAAGCTGATGCCTGATACGTGACGTGACTTGTCCACCAAGGCGATTCGTCTTCACTAAAGT
GGTGCAACGGTTGCTGATTTACAATGATTTACAATTTGCGTTCATTTTGCATTGCACTGTACAGTATGAGCGCACCCAAGATTGGGAAAACCAAAGTATC
ACATCTTAGCGTATGCATAAGAGAAAACTATTAATTTGCTCTCAGTCTAAACTATTAGTAGCATGGGAGGGCTAAGAAATAGTTCAATGATTATCTAATT
GCAATGGCAACCACATTTTAACCTGTTTGAGACTCTCCCAATTCACCTATATTTCTAAGATGTACTGATTTGCGATAATCACTTCTTAATCGTGTCCTAC
CGGTGATACCGGTACAACCATCCTATTTCTGTCGACCGCTGATTACGCTCTGAACTGCAACTGACCATGTCGCATGTCAGTGGCATTTTTTTGTAATCCG
TAACGTACTACCTTTTATTACCCAAATTTGATTGGAAACCGATGAAAATACAGTACTGTACCCACAATAGCGCTCGATAAATACCGGTATCTAAACGGTA
TGAGTAGCTGCTCCTTTTTCCACCAACCCAGTCTTCATCATTCCAAGAGTGTGTCTATTCAAATTCACATCATCATTTATCATTCATTTATAGAAAGCAG
CACGAGTCCGAGTAGTTAGGCATGGCGCTCCGGAACGCAAGCAGAGGCCGAGGGCTCCACAGCCACGCGTGCGTGGATTTGTACACGGAACGCGTGGTGC
TGCCGCGCGTGGCGCTACTGGCGTTTCTTGTAGGCGTGACGGTGCTCACGGCGCTGGGTGTGCGGTGCTGGCGGAGGCGGCGGCGAAATGCACCCTCCCA
CGCCGCAGTGGCATCGAGCGACGTGCTCTACTTTGGCAAAGACGACGGCAGACACAGCAGCGCCAGCGCGCTCTCACAGCACGAGACGACGGTGAAGGCG
ACGATGTCGATGCGGTCACCGCACATGCAGATGGACAAGTGGATGGCGTACGTCATTGGCGCGGGCATCGTGTGGACGTGTCTGATCCTGCTCGGGTTCC
AGTCGTACGATCATCTGTCGACAAGTTCTTCCTCGTCGCTTGCAGCAGCGCGACCGCGAGTCGTGTTCAGTTTTACGACGATCTCTGAGGGCGTCACGAA
GATCCAGCCGATGCTCGACGCGCTGATCAACCAGGACGGCGAGGGATTTGATACCATCTACATTGTTGTCCCGCGCGTATATCGCAAGACACCGATTGAG
ATCCCTTCGTGGCTTGTACGAGATATGGAGAAGGACTTGAAGCGGTCGGATTTCCATGGCGCCACGTTCGCGGTCGGCGTCAGCGCGTATCACGAAAAGG
TGTATCTAATCGTCATCGACACCGATTTCGGACCAGCGAGCAAGGTGCTGGGCACGCTACTCGTGGAGCAGGACCCCGAGACGATCATCGTGTATGGAGA
TGACGATCGCGTGTACCCATCGCAGCTATGCGATCGCGCACTGCACTACACGGCCAAGTACCCCAACGAAGCGATCGCGGTACTCGGCGGCTGGATCGCA
GCCGAAGACTCGATGTACTGCGGTCGAAGCCTCGAGGTCGGTGTGAACCGCGTCTCGTTTGTGGGCGGCGCCGGCGGTGTCGCAGTCAAGCGGCGATTTT
TCGGCATTGGAGAGGCGACGATGCCTGCGTTTGAGATTGCGAATTTCTCTAAAGCGTGCTTCCTCGGGGACGACTACTACCTCTCGCATCTGCTGAGCAA
CAACGGCGTCTCGCGCCGACTCGTGTTCGATAGCTGCTGGAACATGCAGAACCTGGGCGTGGCATATTCTCGTGGCGGGTTATCACAGGCGGCATCAGCA
CACCCCGGCGGTGCCAACGTCGAGCACTACCAGCAGTGCATTCGCGAATTTGGCGTGGACCAAGATCTTTCGCGCGATGGCGAGTTCGGTGCGCTCTTCA
TGTATGTGTTTTCGCGTACATGGGGCGTTTTCCGAGGCCTGCGAAATTTGGTCGTGAGCAGCGTGTTTGTGCCTTGCTAGATTGTAGGACGTTCTTGAGG
GTAACTGTAGGCAGAACCTGCCGACGCGTGCTACTTAGTTTATTTTATATATTAACAGCAAAGACATTTTATGCCAGCCTCTAGCTATTCATAAGGCAAT
AATAATATGCGACCGTGCGTACAAGTTGAGAGAATACGATACGCTTGTTGACGGCTTTGCTGGCGTGCTTTGAAAATTCAATTGATTCGTGGGACCCACA
ATACAACTGCACCAGAGAATACAATCATTCCTACTATACCAATCACCAAGTGATGACGATTTTCCATCGCCCATCGTTCTGCATAATCACTGGATCGTGC
TTTTTGTGGTTGGGCTCCAAAGAATCTGCGACGTGTACACGCCATGATCAATAATGGCACACAGGCATCCAATTGCGTTATGATTACAGTTATTATTGTA
CCCTTCACAAATTTTGTCATGCTTTTGTGGTCATAACGCAACCTTTAATTAATAGTAAAGCGTGGTTTAAAGAACAAAACGACATTAACTTACTCTCCAA
TTCAACCAACCAGTTTCAGAGTTCAAATCACCCCATAACTCGTCATTTTATGCTTCCAGACATTTGCTGATGGTTGTAATGGCGACAAATTAACCACCAT
TCCAACGATTCTGAAACAATTTTACCATAAAAGCACGAATTGAAACGTAATACTTTCTGGTAATGCTATTGACAATTTAACGTTTTTTAACGTTCGGTTG
AGGTAACTGCGTTAAATATGGCGTGAATTTGCCAAAAATCTTGAGCACAATAATACCTCACATCTTGAGACCATGGAAGAGCAGCTGTTTGAAGGCAAGT
GACCCGGAAATCACGGGAGTTCTTGATACCAAGAGGTTTTGCAGCGCAACGGAGATGAGTACTGTATCTGGTAACCAAGTGTTCATGCTAGGAAGAGGGT
GCTCGACTCAATATATACCGGCATTTTATCGGTATGCGCTGGTCTCAGGAGCATGCTCCAATTGACCTTATGGAATAGAAGTCCAATTTCGATCAAGCCT
TCTAAAGGACAAACCGTCCTGGTACCAGCTGTTTGTATCGGAAGTTTTAGTACCAGAGCGATCAAGTGACGTCCTTCTAATAAAGTACATCTCAGGGAGT
GAATATATTGAATCCAGTATACACACCTCTCTTGAGAGCAAAACCGGCAACTCTTTCCCACACGTTTCGCGTCAAACATGGCGCGTGTGGGAGGAATTTC
TATAATACAGTACATATGTACTGATTTTGCCCCCAGAATCCCATCGGCTATCACAAAAACAGTCAAAACAGTACATGAGCATTAAGTTTGCATCTGGATT
TTTAGAACCAAACCGTACTTTGAAAGCAGTGAGGGGATCCGGACTTTTATTTATTTTAGTCGGCCTCTTCAAATAAATAAAGCAACATACAGGTATTGAA
GAAACACAGGCATTGCATATTACTTTTAGATGCACACAAGCTTTTGATTTAGCGACTATCTTTGCAAGAGTTTCACCGCTACAATC