Description :
From Genome Similarity Track
Location :
Scaffold_206:6382- 7384
Transcript NameFunction/comments
g15877.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGATGGTATGTTCAGTGTGTACGCGTTGCCGTGCTTCGCCAACACGGTGAACG
GCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTCGTGTTTCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGCAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGGC
GCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGACCCGGCCTGCGCGTGATGTTCGTTGCCGTTTGA
AGTGCCTACGCTCGTCGTAGACACTGTGTTGTCGTCGCCAAGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATGCATTGCTCGTATCAGCGTGC
TTATCCGGTTGTTTTGAATTAATCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTTGGTACGCGTGGGTGTCTCATGGAATTCA
CGTAGAACAGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTA
GCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTTTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGT
GTAAACACTTCTTGCCAGAATTGCGCTGTAAAGCGCGGATCCTGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACA
GACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCCGAAGCGGTCAACAAAGACCACTATGCCAGTCCTCCGCTT
GT