Description :
From Genome Similarity Track
Location :
Scaffold_947:6381- 10571
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_947-snap-gene-0.5Phospholipid-transporting ATPase

Sequence
4190 bases(100 bases per row)
ACTCTTATGAAAGGTGCCTGCTGATGGAGTTGCGCAGCGCCGCCGGCACGGCGTCCGAGCGCGGCAGCGAGTTGGACGCGATGTACGACTCGGCCAGCGT
TGTCTCCTCATCGCAGCTGAACGCGTAGCCCGTGTTCCTCCGCGATGCGTTGTTCGTCTTGAAGAACTTGGGCGGGATGCGGTCCCAGCCAGCCACGCCC
ATCTCGCCTGTCTCTGACGATACCGACGAGCTGTACACGCTCGCCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTCCGACAGTGCCGAGC
TCTGCATAGCACGCACGGTCGACGCGACCTCGTAGTCGTCGCGGTCCTCGCCTGCGGTCACGTGGCTGCTGCTGTTGCTGCGCTCGTGCAGCTGGGTGCC
CGCCGAGTTCGTACGGTACGACTTGACCGTGAGGTCCGTGCCGCGGAAGTCGCCGCTCAGGAAGCCCGTGTTGTGCACATCGTCCAGCGACATGGACAGC
GTCTGTTCCTCCACGTGGTTGATCGTCAGACGGCGCTTGCGTTTCTCCACCGACTCGGACAACACCTGGTTCAGCTCCGGATAGAACGTACGCTGGTACT
GGTTGTACGTGAAGTGGCGCCCGAGCGCAATGACACAGCCCATGAGCACCACCAGCACGTAGCCCCAGCTCCAGGCAGTCGGTGCGAAACTCCCGAACTC
GTCGTACGCAACCTTGTACTTGGCGAAGTACGGCACTTCGGTGCCCATGGTCGCAAATCCGAACCACGAGAGCACGCTCAGTGTCCAGCACGTCAGCGCC
AGCAGTGTCCATGTGTCCGAAATGAGCCAGATCTTGAGGTTCACGATCAGCACGGTCATGGAGAACGCGATCATGCCGTACTCGACGCGGGACTCACTGC
CAGGCGCGCTCTCTGACGCATTGAAGCCGAACGACATCACCACGAAGATCACGAGCGACTCATACACTGCAGCGCCGACCCAGCGGAAGAACGTGTACAT
GTTGAAGTAGTAGCGTTCGGGACCCTTTCGGTACAGATCCGGGTACTCGGTGCTAAAGTGCGCCGGCAGGTCCTTGTCCATCACGCCGACCACGATGATC
GGCAAACCCGTGAACGCAACGTTGTACACTTGCACGCCCAGCTCCCAGTACATCTTCGACCCTGACGCGCCAGAGAGGTACCCGTACCAGTACTGCGCCA
GCACAAGCGTGATGTTCTTGTAGAACATGTACAGCACGAGCTTGGAGATGCGGATGTAGTTCCAGCGGCCGTGCACCAGCAGCAGTCGCTCCAGGAACCG
AAACTGCGCGATCGCGTAGTCGCTCGAGTTCACGGCTTGCATGCCTTCTTGCCCAGAGATGCCGACGCCAACGTGCGCCGCCTGGATCATCGCCACGTCG
TTTGCGCCATCACCGATCGCCAGTGTTCTCGCAGACGTGATGTTGTCGCGCACGAGGCGAACCATCTCAGCCTTCTGAGCTGGGGACACACGGTTGCAGA
TCACGGCGCGGCAGAGCTTGGCGAACTCCAGCAAGTGCGGCGCAGTGCGCGCACTGAGAGCCCACTCCAGCGCCTCACCGTCGATAATGAGCGAAATCTC
GAGCCGCGAGTCGGCTTTCCGCTTCTCCTTGTACTCGCGCGCAGCAGCGTTCAGTCGCGCGATGATCGCCTCTTCGTTCGGACACGTCGTGCAGTTGACA
ATGACTTGCTGGATCGAGTTGTCCAAGAGCGAACACGCATACGCAATGTTGATCGCTGTCTCTTCCTTGTCTCCTGTCAGCATCCACACCTTGATGCCCG
CAGCAGTCAGGTTCGCGAGGCACTTGGGGACGCCGTCCTGGAGCTTGTCCTCGATCGCCGTCGCGCCGATCAGCTCGAGGTTCTCTTCGATCTCCTCCAT
CAACGTGTCGATCGCGTTTGGCTTGCCGTCTTTTCGGCGGTCCAGCTCCGCGACGTTCCCCTGCGCTTCGTCGAACTTGATCTTCCACTTCTGGAACCAC
TTCTCGTCCAGCTTCTTGACTGCAAGCGCCAGCGTGCGAAGCCCGTCGTCCGCGTACTTCTCCATGTGGTCGCGCGTGATCTTCTTGAGTTGTTCCGTGG
AGGGGTCGTCTTTCAGACGCTGATAAATCATCATATCTGCCCCTTTCGTGTACAGATACAGTTCTCCATTCGGTCTCCTCACTACCACCGACATGCGTTT
GCGCGTGCTGTTGAACTCGAGCACGTCCAGCACATCAAACACCTGCCGCTCGCCGAGCACTTCAATGGTCGCTTTGCCCACACCGCGATTGATGAAATTG
AAGCCCGCGAACGCGGCGCCTGCTACCAGCGCCTGCTCATCAGGTGACGACGCGGACAGACGCACTTCTCCAGTCTCCAGCTTCTCTGGAATCACCGTGT
GACACACTGCCAAGTGCTCGAAGAACATCATGATGTTGCGCTGCTGCTCCGCACCGGCGCGACCTTTCAATGCCTTGAAGAACGATGGGTCCACGAAGTT
CACGTACTGCATCTTCTTCATCCCCGCCTCCATCTTTGGCTCGTGCGGGATCGGCTTCCCAGCACGAACGAGCGCCGCGCGACCGATCTCCGTCAGCCCC
GAGCCGTATGAGATGCCGTTGATCGAGCATTTGCGGAATTCCATGATGTTGCACGTGAGCGTGCCGGTCTTGTCGCTGAACACGTACGAGATCTGGCCCA
GCTCTTCGTTCAGCGCCATGGTGCGCACGATCGCGGGTGTATCGGTCTCGGCGTGGTACATCTCGCGGTCCCACACCATGAACTTGGCCTGCAGGAACTT
GACACTCGTCATTGACACGTAGAGCGAGATCGGGATGACCTGGTAGAGCAGCAAGAAGTAGTAAAAGAGCATCTGGATGAACGACTGCCAGCGCGGTTGC
GCGCGCACGCCATCGTCCAGTTTGATGTACCACGTGTTGCGCACAATGTCGTACTGCCACGTAACGTAGCAGGTCGCCGCGACCGCGCATGCCACGAAGA
GCCCGAGGCACAGGATACCGATCATCTTGTTCATCGAGAGCATGACGTCACTCCACTTGGACGGCGCGGCGCTCGCGCTCTGCATGATCTTCGTGTCCGG
CCCCGTGTTGAGCACGAGTCCGTAGACCCAGTCCGTGTTGCGCAGGTTGCAGCCGCGCAGCAGCACGTTCTTGACCGAGAGTGGCATGACCTCCATGCCG
CAACCTTCACTCACCGTGACCTCGACCTTGCCAGCAAACTTGTTGATGTACGGGTTCGGCTTCTCGAACTTGACGATGCCGCGCAGCAGCATGAGCTCCT
GCGGATTCACAAGCGCGCTCATGGTCGGCTGGATGGCCTGGCGCAGCTTCAGGTTCGTCTCGCCGTCCAGGCTCTTGGTCTCCACGTAGCAGATGCCGCT
CGCCGCCTCGCCCACGGGCTCTGAGACCGCGAGGATGAGCACGTCCGCCGGGATCACCTCGCGGTTGCGGATCTGCAGAAAGTCGCCCACGCGCACATCC
GACCAGAGGTGGTCCTCGATGTGGCCACTGCGCACGATGTGGCACTTGGCTGAGTTGGCCTCGTTGTCCGACTGGTGGCGTCGCAGGTCCTCCATGATCG
CGAACACGGCGTCGATCGAGATGACGAAGAGCAGTACAGGCGCGTTCGTGGGCACGCCGTACGTGTTACTGATCGACTTAATGGACTGCAGCACGCAGAC
CACGAGGAAGAAGAAGTTGGCCACTTTCGTGAAGCTCTCTTTCAGGAACTTGGGCAGGAACGTGATCACGTTGTACTTGGACGTGATCACCACGTTCGTT
GACTTGTCGAAGACAGCGTTGCCCGGCGCGTAGTTGAAGTACACCTCGCGCAGGTCCTGCTTGGCCTCGTCGGCCGCCATGGACGTCGTGCTCTCCAAGC
TGTTGTCTTTGCTGTTCTTGCTCGGTCCGGGTCGGAAGCCACCACCGTTGCCGCCGCCCGTGAGCGTGCGCTTGGCGCGGATTTGCTGCTCGTCCGAGCT
CGCGTCGCCCCCCAGCAGGCGCTGGTTCTGCAGCAGCGCGGGACTGCCCATCTCGGCGTACATGTCACTGTTGCCACCGCTCTGCTTGCCCAGCAGCGGC
GGATTCGAGCCTCCACCGTTGCCGTTGCCGCCCGTGCTACGTGACTGGTGCCGCAGCAGCTCCTCGTCCTCTACGCGCGGGCCGCCGCCG