Description :
From Genome Similarity Track
Location :
scaffold_687:6379- 8223
Transcript NameFunction/comments
g9876.t1 Proton-dependent Oligopeptide Transporter (POT) Family

Sequence
1844 bases(100 bases per row)
TCGCCTGTAAGTCGGCATTTCGCGTCAAGGAAATCGCTCTCGCCATTTCCAATCTTGCCCTGGCCAGCAAACATGTCCAAGGTGCAGTCACCGGCGCTCA
CGCCGCAATTCTCGCCGTCCGTGACCGGCTACATCAACACGAAGCTCTGGGACGAACGGCCGGTTCGGTATGCCGCCAACGTGTTGAAACACGTGTGCAT
TTTCCTCCTCATCCTCACGGCATGTGAGGAAGTCACGAGCTTCGCCATCGGCCAGTCACTCAAGAACTTTTTCCAGAAATTGGGCTGGTCCAACAAGGGG
TCCACCTCCATGAAGCTCACGTACGACTCGTTCAGCCAGTTCATGTGCATCGTGGCCGGTTACATCGCTGATGAGCGTCTCGGCAAGTTCAAGACACTGC
TGTCAGCTGCGACGTTGGACTCTTTTGGTCTGCTTTTCCTCGTAATCGCTGCGTTGCCAGCCGTCGTGAACAACCACCTGGGAGTGAGCAAGGCGATCTT
CAATATCGGACTGTTCCTGGGTGTTGCAGTCTCTCAGATCTGTCTACGATCCCTCGTGATTTCATACGGAGGCGACCAGTTCTCTCCTGCCTCTCCACCA
TCAGAGAAGGCGCTGTTCTTCAGTATCCAGTACTGGGTGGCCAACATCGGAGCTTTCATCGGCTATGCAGTGTTCCCTTCCGTGTCGATCCACGGCTTCG
GAGCGATCCCTGCTGAATACGGATACGTCAGTGTGTACCTCGTGGGTTTTGCGATGTTATTGATCTTCGTTGCGCTGCTGTGGTCCACTCGCAAACGCTA
CGTGAACGTCCCTCCTACTAAAGAGTCGATCGCTCTAGTCATTAAGATCGTGATCAACCACGCCAAGAAGAACTTCAGCGCTCAGATGGTCGTGCTAGGT
ACGGTTCTCTACATCGCCGCCTTCCTGCTTAACATCCTGGCGTCGATTCTATCGGACCATGGAGAAACTGGACACAACATCTCGTACGCTTGCGGAGTGA
TGATCGTCATTGCTACAATTCTCTGGGTCTACTTCGGACAAAGCTCCGAGTTCATGGAGAGCGCTAAGGACACAGTCGGTGGACGATTCGACCCGGAGCT
TGTGAACGGCGTCAAGCAGGTCATCCGGATTCTTCCGTTCAACGCCTTCAACGTCTTCTGGTGGGTCTGCCAGAACCAGCGTGGAAACAACCAGTCGATC
GTCCAGCAGACCGACACGCGCCTTGGCAGTGGCCCCTTCTCGTCCCAAATGCCAGGCCCCACTGTGCAGATGTTTAACCCCATTGGAGTGCTCATTTTCG
TCCCTCTAATGGAGAAGGTGGTCTACCCTTTATACGAGAAACACGCAGGGAAGCCTGCGAGTCGATACGGTAAGGTGCTGACTGGATACTGCACTGCTGT
TGTGGCTATGATCTGGACTGGATGCTACGAGATCATCCGTCGTAGTACGACTCCACTTACGTACGTGGACTCGAGCGGTGTGACGCAGTTCATGATCAAC
GACGACGGGAATCAGGTGATGAACGACATCCCGTGGTGGACGGCCATCCCTCAGTATCTGCTGGTTGCACTGGCCGGAGTGATGATCGCCATCCCTTCGT
ACGACATCAATTACTCAGAAGTCCCTCAGAGCATGCGTAGTACGTCCATTGCTCTCGGGTTCTTCGTCAACTCGATGGGTAGTACGCTGCTCTCCATTAT
TGTGCTGCTCTTCGGCAAGTACATCCCGGCCGACCTCAACAACGGCCACATCGAGTACATGTTCTTCACGTTGGCTGCCATTATGGTGGTCAACATCTTC
TTCTACGTGGTGGTGATGAACAGGATGCAGCTGGGGATGATTCC