Description :
From Genome Similarity Track
Location :
scaffold_5:637878- 639199
Transcript NameFunction/comments
g8235.t1 hypothetical protein PHYSODRAFT_476401
g8236.t1hypothetical protein

Sequence
1321 bases(100 bases per row)
TAACCTTGATGGCCTCGAGGGTTCCGATCTGCTGAGGGGTGTTGTCGGCATCCTGCCATCATGAAGATGCCAAGTGAAGATTCAGATTTATGTTGGCTTT
CCTGAAGCTCCAAGAATTTCTTTACCTGAATCCGCAACTCGAATGGTGTTTCTCGGTCGTAGATCACGCGAAAACCACCCGCTGAAGCATCAACCACCTC
AGCAATGGAGGGGTAGCCAGCAACACGACAAATGCATGGAACGCACCTAGACTCGGGTCCAACTCGTCGGTCGTGCTCACCGGAATGTGAGCTTCACCGT
CCGTGCCACTCACGTCCACATACCTCGACGACCCAATAGAGGAAGAGCTCATAGCCATAGTCGTTGCTTCAACGGAGGCTCCGTCTATTTATCTCTGGTG
AATATGGACGCCGACCGTTTTTCTGATGCTGCGAGAGACTTGAAAGGTCGTTGGTGGTGGTTTGGTGTGCTCTTGGCAAATGCTTGTCATGGTTTCCGCT
AAAAATACGGGGGCGAGGCGACGGAAATGGACTTGATGGCTCCATCAGGGCTTCACAGATCACGAGACATCTTACCGAGCAGCGGAAGGCCAAGAACATC
GCCTTGACGCTGCATTTCTGTCGGCAGAATGGTTTCTCTGGGGCGTGGCAGTAGGATTGGTGAACTCGCATTGGTGGGTTGCGAAGAAGACGACGAGGAA
ATCACCCTGAGCAACTTCGATGAGACCGATACGACGGCTGATCCTATTCTGACCAGCCCACGCTCAATCGAGGTATCAAGGGCTCATTCGCCTCCATTGA
AATGCGTGCTAACTTGATGGCTGTTCTGTTGCTTAGGCTTGTCGGATGCTCGGTGTGGAACCTGAAGAGCTCGTTCAACGACCTCTTGAGTATTTTGTCC
GTTCATCTGAACGTGGACGATCGGAGAACCACAAATTTGTTGCCAAGCGAGCTGCGCGATATGAAAAGAATCGTCAGGTGCAGCTTCGTAATGTACGAGC
ACAGCGACAAGAGCTTATCGAGGCTCAGCTACGGGGTATTCGTGGCAGTATGTCTCTGAGAACGCGCAGCTACTGCCGTTCTCCAGTGGGGGCAGCTCGA
CTCGGTTTCCCAGGAACAACTTACAGTTGCTGCAGTTCTCAAAACGATTTCAGCATGATTGAACGGGAGAAACGAGAGCTGGAGCGGATCCAGCAGCGGC
AAGCCCTTGAAATGCAGCAGATGCTGAATTTTGAACTGAAGATGAGCGATCTCCACCAGGAGCGCGAGAAGAAGGAGCGTGAGCAAAAGCGGCGAGAAGA
ACTATTTGCAAAGGAGCGTAC