Description :
From Genome Similarity Track
Location :
Scaffold_536:6378- 8896
Transcript NameFunction/comments
Physo_145149hypothetical protein

Sequence
2518 bases(100 bases per row)
GATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTCACACGAGGAGAAGAGGACGATCCC
GCCGTTTGACGGCAAGGACTACGAGGTCTGGCACGAGCGAGTCAAGCTCAAGCTGGAGAGGAAGAAGCTGTGGAAGTACTCCATGGAGGACTTGCTCGAG
CCGGGACGAGAGCAAGGAGGCAGAGGCGCACGCGACGTGGACGAGCGAGATGGCCCACGCCAACGAGATCATCTACGACGCAATGACGAATCACATAATG
AAGACTGTGAAGTATGAACCCACCCCGTTTCGTGTCATGGAGCGCCTGAAAAAGAGATTTATGGGCAAGACGTACCTGAAGTACGCTGAGGAGAGGGCCA
AGCTCAGTCGGCTACGGCTCGCTCCCAACGGCAATGTGCCAGATCACCTGAGCGAAATGCGTCGGCTGATGGAGACCATTGCTGGAGTCGGGCGTCCTGC
GGACGAGTATGTAAAGCCAGCACTATTGATTGGATCTCTGCCGCGCGAATATGATCATGTTGTACAGACGTTTCTCGCCAGCCACAAGCCCCAAAATGCT
GATGATCCTCCTAATTACGAACAACTTGAACTCGCATTGGAGATGGCTTACGACCATCGCCAAGGTCGGAAAGCAGAGGGCGCCAAGGACAATGATGATG
AAGAAAAGGCGTTCTTTGCTGGTGGAGGAAGAGGTCGAGGACGTGGTCGCGGCCGTGGACGTGGTGGTCGATCTGGAGGACACGGGCGCGGTTCCGGTGG
TGGACGTGGTTCTGGCGGTCGCGGGAGCCAAGGTGGTGGACGTGGAACTGGACGTGGCCAAGCCGGCAGTGGACAAAAGCCAGGTGGTGCTTGTTATCAC
TGCCATGAAGCAGGGCATCATGTGTTTGATTGCCCGTTTCTTGGCAAGCGACCTCCAGTCGAGGATCGCAGCAGCACCCAAGCTCAGAAGCGCGTGAAAA
TGAGTGGAGGAAAGAGTGCTAAGGCTGCTGAAACGAGTAGCTACGCTAATGAAAGTGATGACAGCGCGTATGTTATTCTTCAAGTGATGAAAATGAAAAA
GCCGGTCGCAGACAAAGCCCATGATAACTGGTACCTGGACTCTGGTGCATCGAGTCATATTTCGAACCAGCTCACTGATTTCATGGAGTTCACGCCTCTT
AGCGCCCGGATTCGAGTTGGAGGAAAGAACTCGCTGGATTGGTACTGTGGTTAAAGAGCTGGAGACTACTGGTGGGAGGTGCTAACTGACGCTGCGAGGA
GTTCGTTATGCTCCAGAGCTGCAGTGCAGTCTCTATTCTGTGCGACGGCAACTGAACCAATATCTGCCTGAACGTGATCGTGTGAAGGTGCACTTTGATG
AGGCAGATCGCGCTGATGTTATCTTACAGGCTGGTGTGACTACCGCTCAAGGTGATTATACCAATCTCTATCGCTTGAAGTTGGAGAGACCCCAAGAGGT
AGCCATGGTGGCGCTACCAGGTCGAGTGAGTAGTTTGGAGCTGTGGCATTCGAGATTGGGGCACCCTGGCAGATACTTGTTTAATGCGCTGTTCAGCCAT
GATCAGTGGCCATTGCCA