Description :
From Genome Similarity Track
Location :
Scaffold_24:637606- 638933
Transcript NameFunction/comments
Physo_133199pectin lyase 2

Sequence
1327 bases(100 bases per row)
GCCCACACCAAAGTTCTGGCTGGTGGTGCCGAACTTCTTGGCGGACGTGGGCTTGTAGTAGCTGGCCACCTTCTTGGAGTTGGCCAGAGCCGCCGACTCG
CGGTAGCCCGTCAGCGTACCGCAGTTGGACACGACGTTCTCGACGCAGTTGCGGCCCAGCGCGTTCTTGCACGCCGACTGCATGGTCGAGGACGGCGCGA
TGATGGCGCCCACAGTCTCGGCGTCGTGCTTGTTAGGGATGGCCGTGTTCTCGAAGTAGGTGCCCTCCAGCAGCACGTTGCCGTTCTGCAGCACGTCGTA
TGAGAAGCCCGTGTTGTTGACCCAGTAGTTGTTGACAGCGTGGACGATCGAGTTCTCGGCGACCTTGGGCGAGCGGCCCGACGTGTTGTGCACGTAGTTG
TTGACGAGGGTCACCTGCGTCTGCGTGCCCAGGAAGAGGAAGGTCCAGTAGTGGTTGCCGTCGCACGTGGCCGAGTACTGCGTGCGGCCGTCGAACTCGG
AGTTGCTGATGGTCATGCTCTTTACACTGGCCGAGCCCGTGGCGATCATCTGGCGGCCGAGGTTGGAGATCTTAACGTGGTCGATCCAAACGCGCTCCAT
GGGGGTCTTGCCGCCGTTGAGGCCCTGGATGTAGATAGCGTCGCCGCCCCAGATGAGGTGCGCGTTGAGCTGCGTGATGTGAATGTTCTGGATGATGATG
TTGTTGCCGCGGAGCCACAGACCCTTGCCCTTGATCACTCCGTTCGTTCCGAGGCCGCGCAGGGTCTTGTTGTCCGAGACGATGAGCGGGTTCTTGGTGG
CCGCGATGTCGTACGTGATCTTGACGGACGTGCCCTGCACGCAGCCGCCCGTGTTAGCGAAGCCGCCGCTCTGCAGGATGACGTCCTGGCCCTTGTAGCC
GTTGTTCTTGGCGAGGCAGTCGCGGTGGCTCTTGGGACGGCAGCCCGTCTCGGTCTTCGTGCCCTCCGAGCCGCGGAAGTCGAAGGTCTTGGTGAGCACG
ATGACGCGCGGCTGCGAGTCCTGGAGGTAGTTCCTCAGGTCGTTGAGCGACGCGGGGTACACGGGGGCGATGTTGCCACCGCCGGTGGTGCCGGCAGCGA
GGCCCGGGGCAGAGCCCGTGGAGATTGAGCTCTTGGTGGTGACACCCTGTTTCGTAGACGTCTGGGCGACATCCGAGTTCTGCAGCGCCGTCGTGCTAGA
ACCGGCGTGCGCGCCCTGCATGGCGAACGCGGCAACGGCAACGATAACGAGGCGGAAGATCTGCATTGCTGGCTGTTGCGCGGTGTTGGTTGGAGACTTG
TGCTGCGCGAAACGAAATCGATAATGA