Description :
From Genome Similarity Track
Location :
Scaffold_755:6376- 8626
Transcript NameFunction/comments
Phyta_totarag10543hypothetical protein

Sequence
2250 bases(100 bases per row)
GGGCGCTTCATGAGGTTAGGCGCGGCTCGCTAACGCGCCCGTTAGAAGGGTTGCCTCATATGCCGCCACGCAGTCCGGAACGTCTGGATGAAGCACCGCG
CGCGGCGCCAACTGTCCTCTATTTGGCTCAGCCATCAGACTAGCGGTGCGGAGGAATATCACCGTCGCGGCGACGAACGCCGCGACTCGTACGCGCAGGC
CGTGGATCACCACAGGTATCGTCGTACCGAAAAAAAACATATCGCCTCCATGATATGACGAACGTGACGAGCACTATCCAGAAGTGGTGAAGGCCCGTCG
CGCCGGAATGGAGGAGCGTGCTCGCCGGCAGAACGCTGCGAacgcgcagcgtcttgatcATTTAGCTCGCCCCCTGGATTAACTAGAACGCGAGAACGTG
GAACTTCGACACAGGTTCCGTCAGCATGGGACACTTTGCCAAGCGTCGCCGCGGGAGATTAGCTGGAACGCTGACGCGTGGGGTTACCAGCGTCCCTTGC
TATAACTACAGGACAGTACCGGCGTAAGCAACCGACGTAGAAGGTAGCATGTAAGCAAATAGCTGTAGGGAGCCGTAGCGTATATGCTTCCCCTTATACC
TTTGTCACTTTAAACGGCCTAATAATTTGAGGCGCGAATTGCTTTAGTCACCAAAGCAAGTTGAATACCGGCCGTGGATAAAAGAACAAGATCGCCCACG
GCAAACTTCCCCAAGTTCTTGCGACCTCGACGATCAGCATGCTCCTTCTGACGGTCAACAGCTGCCGCGATCGCATCGCGGACATAGCGCGCCACGgtct
tgcgctgctgaacgaaCTCATTAACGACCTCAGCGTCACGTGGCTGCGGTTCCAGTGTGAGATCGACGTTCGCTGGGGATGGTGCGGCTGGTCCAGTCGC
GTCCGGCACATCTTGCAACTCGACAGCACGATGACGTCGACGCAGATTAATCAGCGTCTGAGAAGTCCAAGCTGTAATGGCCGTCGGTGTCGCCCTTGTC
GTGTCGCACGTGGGTAAACCTCGTGCAGAAGTCTCGGCagcgttgctggtgctgcccTCGTGGCGGCGCGCGTGCGTACTCCCTGCACCACGGACTTGCT
ATCATGTCGTGTCGTAATGCCATTCAGCAGGGTGGAGACAATGTCGTGAGCGCTTTCACGACAGTGTACACTAGCGGACTCGGCATCGCTAGCAACTAGA
TCATTagaagaagtcgatgcaTCACGCGACTCTGAGGAGTCCGTGTCCTCGTCATTAATCTCACTCGTCGAAAACGAGCGCTCCACACCAAGGAGGGCTG
GAACCCGAGGGTGTCGGCCGGAGTTAACGTAGAATGGTGTGGTCCTTTCGACGAATGTACGGCGTTATCAGGTACGAACTTGACCATGGGCAAGAACGTG
CTCCACGAATTGTACGACGTAGCGAAGCTTCGCAGCACATCCTCGACCACTCTGATCACACGTTCGGTCTGGCCGTCCGTATCTGGATGGGCCGTGATGG
ACATGAGCAACCGCGTGCCGAGTAACTTGAAGAGGTCCGTCCAAAAGACGGTAGTAAACCGGGGATCTCGCTCGGACACAATCGAGGTGAACAGACCGTG
GTGTCGATACACGATGTCAACTAAGGTCACCGCGGTCTGGTCCGCGGTGGTTGTGCAGCAACCGGAGCAAGATGTACAATCTTGCTGAACCTATCAACGA
AGGCGAGGGTACCGGTGCGACCTTGAGCATCGCGAGGGAGGCCAAATAAAGAGTCGATGTTCACCAAGCTCCACGCGTCCGTCGCGAGACGAAGTGGGCG
ATGCGAAGCCTGCTTCGACAGAGTCGGGTTGACACGCTGGTACGTTTCACAGGAGCACACCTACTTCTGCACCCACGTGTACATAAACGGGCAGTAGAAG
TCGCGAGAGAGTGACGCAAAGGTCTTCTCACGATTGGGGTGTCCACTGCTTGGGGTGTCGTCAAATCCGTGAATCAAACGAGCGCGGAGGTCGGCTTCAA
GTAGGACGCCGATACGTGAAAGGTCCGCACGGTCGACGCGGTAGGTCAGCAGATTCTCGCCCAGGACGTACCGGTCTATTCGGGCACGGCTTTGTCGAGT
AAGTTGGTGGCTAGCCGTATCGAACTGTTCGCGCAggtacttcttcatcttggacaTACCATATCAGACTCATACGCGGCTGTAATAAAGTCGCGAAGCG
GGCTGGTCGCTGTGCCACACAGCCCACTCGTCATCATCTACGTCGCCAAC