Description :
From Genome Similarity Track
Location :
contig_10:637459- 639034
Transcript NameFunction/comments
g2859.t1hypothetical protein F441_13150

Sequence
1575 bases(100 bases per row)
GGCTGGTTGCCTACCAATAACCGGTTGCCATGCGGCCACGGACACGCAAAATATTGGACCAGCAGCGGCTTCCCGCCAGTGCTCTCAGAGTCATCTCGGA
GGGCAGCACGTCAGCTGGAGGATTGACGAGCCGCAACTACAACAACAAGCACGCTGCTGTTCGACTGCGCGCAAATCCCCAGCGCCCGTCGCATGTGGAT
CCTCGCGCTTGAAGCTGCGCGCACCGGAACTGGTTTAACGCCTCTACGACATCCGCATGCTTGGCGCGGCTGGTGCAATGCCCGACTCCCTTTACTGCAA
CTTGTCCGCTTGAACCTCTGCGCGCCAGTCAAGCCCGGGAGCTCTGCCGACGGCATCGTGCAAATTGCGCCGCCCCCATCCTGGCGTAAGCCGCCGGTTG
CAGTTGCAGGAAGACACACACCTTGCAGCTTGACGGTCCGAATGCACCGGAAGTGGAGTCTTGTCGATTGTTGCACGTCCTTCGAGATGGCTACAGTTCT
GCAGCACGAGGAATCGCAAACTGGAGCCCCCACATGCTGAGACCGTGAGGGGGGGGCTGCTGCTTTGAGGGACGTTTGTCCAATCGCGAGCGATGCCGGT
CCACGCAATCTGGTGCATCAGGCAAGCGCCTTTGATGCAGGGGTTGGCTCGCGAAATGGTCCCCAGCCTGCACTTGCTGGGTGTCCTGGGGACCATCTCT
GAGGAGCAACAATGGTGCGTGGAGGTGAATGCTTAACAAGCGCATACTGAGGCCAAGTCACTCGGCATCTGGTCCCACATTGGCCCGTTTTGCGCAAGCA
CGAGGATGGGCTTTGCGAGTGAGAAATCAACCGACGTGCAAGACAAGCACCGGCAGCCTGGGCGGCCATGCAGGCACCTGCAGCAGCAGCCCAATAACAT
TAAGCAGCTCTGCCGCCTCTGCATCGCACGCTGGGAAGAGGACGCCAAGCAATAACGCCATCCAAGTCAACCGAAACGGATGGCCAACACGGAAATCGGA
TCTAAGGCAGCGCAGTGCAAAGAACGCTCAAGATCGCCACGCTTTCATTGGCTCAAATTCTTTATCCGGCCCCGTTTCTGTTACTTCACTTCAGCATCCT
TCTGGTGGTCTCCGCTATACAAAGCGCCATACAAAACCTCGTTTTGCGCATTCCGCATTCCGCGCCGCCGCCCGCTGGCCGTCACTTCCCGATTCGGCAT
GTTCCGCATCCATCGCCGCGCTGCCGCTTCACTCTCCAGTCTCCCGCGCGCGTCGGCGCTCAGTCATGTGCGCGGCTTCCGCTCCTTCCCGGGCGACAAG
CGCGCCGTCTTCCAGCAGAAGGGGCTCTACCGCCAGCTCGAGGAGAAGGATAGCTGCGGCGTGGGCATGATCGCCAGCCTCAAGAAGCAGCCGTCGCGCG
CCACCGTCGTGCAGGCCAACGAGATGCTCGTGCGCATGTCGCACCGCGGCGGCTGCGGCTGCGACCCCGCGTCCGGAGACGGCGCCGGCATGCTAGTGGC
GCTCCCCCACGAGTTCATCGTGCGCGTGGCCGCGGACGGCGAGTTCGGCGCCGCCGCCAAGCAGCTGAGCCTCGA