Description :
From Genome Similarity Track
Location :
Scaffold_631:6374- 8829
Transcript NameFunction/comments
Phyag_g7148arginine biosynthesis bifunctional protein argJ, putative
Phyag_g7149hypothetical protein PHYSODRAFT_307583

Sequence
2455 bases(100 bases per row)
GTTGCTCCAAAAGAATTCATGCCATTATTATGGCGATCTACGAGCGGTAGTCGGCGTTAATGGCCACATACTCGTGCGTAAGGTCGATGCCCAGCACCTG
AGTCTCCTCGGATCCAACACCCAGATCAATCTCCATCTATAGGCCATGAACACAACACAACATGTTCAGAATAAGGTGTGCGAGTGAAAAGAAAAGCATC
GGGACAAAAAAGGCTTACCTCGACAAACTTTCCGTGCGGCGGGAAGTTATGCGAGCTGGCGTCAAGGCCGCCGCGGGTAGGCTCAATCAGCATAGCGTCG
CGCATGTGCGCCACAAGCTTGGCCTCAATATCGTCGTTCAGAACCATCTCGCCATTCTCAAAGATGAGAACGCCGCCCATCCGGATCGTCATACGGCGGT
GGATGTTGACATCCTTGTGGTGCGTACCCATATACTTGCCCACAGCCATGACAAGGCGGCCCACGTTCGGGTCATTGCCAGCCACCGCACACTTGAGTAG
GGGCGAGTTGACCACAGACTTGCCGACGCccttggccatctccttGGACACAGCGCCGCTCACACGCACCCGCATGACGTGGTGCGCACCCTCGCCATTA
CGCACAATGTCCTCGCTCAATCCGAGACACACCTcgtgcagcgccttcttgaactCATCCAGCTGGTTCATGTCGAACGGGATCTGGTCCGACGACACGA
GCGTTACCGTGTCCGACGTACTCTGGTCCGTGTCCACACTGAGCGAGTTGTACGTGTCTCCTACCACCTCCGTTAGCAACTGACGCAGCACGTCACGCGG
AATCGACAGATCTGCATTCAAAATCAACCGTCAGACCATAATATCTCAATAAACATCCTCCACCCCACTCACCCGTAAGGATGTAGGACAGCATGGTCGC
CATATTCGGCTCAATCATGCCAGCTCCTTTGGCAATGCCGACAATGCGTCCACCGCACACGTCCATCGACCGGATCTTCGGGTACAAATCTACAGGCAGC
AAAATAACACACAACCGTAAGTAAACTAGCCCCCTAAAGAGCACTATCAACTACCCACCCGTGGTCATGATCCCCTCGGCTGCAGGCAGCACCGAGTCGG
ACTGCAGATTGGTGATGAGTTTGGGCAGGTTCTCTACCATGGCGTCCACGGGGATACGCCATCCGATGACGCCCGTGGAGCAGGGCAGCACCTGCGTTCC
CCCCTCGAGTCTCAGATGCTTGGCCAGATTGTCACAAACCTCCTCGGCATCAGCCACGCCGCCACCGCTGGCGCAGACGTTGGAGATTTTGTtgttgacg
aggatggcgcCGAGCTTCGGCTCGTCCAGTCGCTTGCGCCCCACGATAACGGGGGCACCGGGGAAGGCGTTCTGCGTGAAGACGGCGGCGAATAGGGACG
TGGGCTTGACGGGCTTGATgagcgtcatcgtcatcttggcAGGCAGGTGGGGCGCTTCTTGCGGGACAAAGtcgaacttggtggtggccacggcAAAGCC
CCAGGGCAGCCGGCTCTGGTGCGTCTGGAGGTAATCCATGTACTCGTGGCGAgactcgaactcgaacggGTGGCCATGTGTGGACAGGcagcgcgtctgc
agcagcgaccgaGAGCGGCGCGAGATGGACGACAAGCGGAGCAGCGTCATGACGGATTCAATTGTGAGCCAGCGGTGCCGCCGGACGTTAAATGCCGATT
TATCTTGTGGCGGCAGGAGACGCGATCCACTCCTTTTGGTTAGATCTACTGGGTTTTGCACCAATAAAACCCACCAAACGCCGTTTAACCCAGCCGCAAA
CTCTCATAAGTCCCAATAGCCCTCCGAATGAAAGAAGAGGGCATCGACGACGGGAACGACTCGGAGGCTGCGTCTGATGCGCCGTTGCCTCCCCCGCCCC
CGCCCCCGCCGCCTCCGCAAGACGAtctcaagaagaaacaaCCGACGCCAATCCAgccgcagtcgcagccgctGAAGCccaagaggaagaaagaCTTTCG
CGAGATTCTGGCGCTTTTTCATGCCGAACCGACGGACGCAGCGACAACCAAGCGCGCGTGGGGCTCACTATGGCAAACGACACTGACGGAGAGTCAGGAG
GACCTCAAGAAGAGGCGACAGCAGGAGCAACACGGACTTaagcggaagaagaacgggGATCACGACCACGGCCCCAGAGGACTCGGCTCGCTCTCTCGTC
ACGGCAGCATGACTCAGGATCATCTCAAACGCGCACGACAGGTCTGCGGTGATGTTCTGCTGGTATTAATTAGGCTATTGTGTTGATGATGCCGGCTTTt
gtatgtgtgtgtgtgtgtgtgttttgtAGGGATCTGCAGCGAGTACGgactcgtccgagtcgaGTAAAGGGGGTCGACTGGGTGGCCGGTTCCCCAAGAA
CATCCCCAAGGGGTCAAAACTCATGCAGAAGTTCGGCGGTCGCGGTTAATATCAA