Description :
From Genome Similarity Track
Location :
Scaffold_15:6373- 8700
Sequence
2327 bases(100 bases per row)
ACCTCTGTCAGGACCCGGGGCGCCCGCAAGGCTGCCACGGTACCAAAGCATTTGGCAGATGCTTGGGAGGCGTCGACGTATATGACGACTCCGAGGATGC
TTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCAAAGTGGGTATCTTAGGTCCACAGGCGGGTAGCTTAGTTCCGCAGACAGCTGCAGCTGTCATGAAC
ACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGAGTA
ACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGAC
CTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTA
GACGTAGGCAGCAAAGCCCGACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTTAA
GCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGTGAGACCGGTTTACCCGTCAAGGCATCTGG
TGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCTCCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACATCAAGGCTGGAGAGATTGCT
GAGATGGTGCTCATAAGACCTGAGACCACTCGGGGGGAGCTGAACTCCTCCTCTGTTTTGGACGAGAATGTCCTGGAAGACCTGAACAAGCAGCGTCAGG
CGCGCTTGGGTTCTGAGATTCTTAAAAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACT
CCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTTACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTC
ATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAA
AGTGGCGTCTGGTTCACGCTGATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGG
GAGCGTAATGTATAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACAACCCGCTCACCGCGGTAAGCACTCCAAGTGGC
ATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGACCCGGCGACGTTCAATCGCCTGGTGACACAATTGTTCCGCCCTTTGCGTACCTTCG
TACAGACGTACTTTGACGACATATTCGTCCATAGCCGTGCCGAAGGAGGCAAGACGGCCATGGAAGTGCACCTAGGACACCTCCGTCGAGTGTTGGACGT
AATGCGAGCGAACAAGCTCTACGCCAATATCGACAAGTGCGCTTTCGCGTCACCAGAGATTAATGTTCTCGGTTGCTTCGTTTGCAACGTGGGCGTTCGG
GCTGACCCAGACAAAGTCAAGGCCATAGCAGCATGGCCGATGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTAGGCTTGGCCAACTACCTTCACAAGT
ACAGCGCAGGGTACGCGGTCTCCGCTAAGCCCTTGTCGAGTCTCCTTGAGAAGGACGTCGACTGGCGCCGGGAGCAGGAGCAGTAGGATGCTTTTGACAG
CATCAAGGCCGGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGT
GCATTGGTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAACTCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGG
AGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGC
GACTAACACGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGCCGAATACAAGCCGGGCAAGCTCAACGTG
CTCGCGGACGCCCTCTCTCGGCGTCCT