Description :
From Genome Similarity Track
Location :
Scaffold_69:63727- 68470
Sequence
4743 bases(100 bases per row)
AAATTCAATCACATCTCTTTTTTCTTCCTTCTACTCAAGCTCCTCCACCTTCCTCGCCTCACCTTCAATAGGTTATGAGCCCAACGCAAGCCTCCACCGC
TGACGACCGCGAGTTTCCGCGCCTCAATGGCCGGAACTTCATCATCTGGAAGACCCGCGTCACTGCCGCCCTCGAAGGAAAGAACCTTCTCGGCTACGTC
GAGCGTATCGACTACACCGGTGACTCCGACTACGAGTTCGACTCCGATGAAGAGCTCAACCCGGCACTGTCCGACATGAACGACATGTCCGCCGCGCTTG
ATGCTGCCGGTGCTCCCAAGGCCGACGAAATAGTGGGCTCCTCACCGAGCGAGTCCTCCTCTGATGCCAGCTCCGCAAGTTCGGATGCACCCACAGCCGG
AGACGACGGCGATGTGGAAATGGGACAGGAGAATCCCCCCGTTATCCAGTCATTCACTGCTCAGAAGCGGGATGAACTGAAGCGAGCAGAGAAGCTGAGG
GCTAAAAGCCAGAGGCTGAGCTCGAAAAAGCTTCGACTCAACGAGGCAAAAGCAAAAGCTTTCCTTATCAAGACCATCGATGACCAACATGTTCTCATGG
TCAAGGACAAGACTACTGCGTTTGAGATCTTCCAGACGATCTGTAGCAAGTACGAAGGTGCTGCCATCCACGGCGACCCGTATCATGTGCTATCATACCT
GATGGCACTGAGGTATGAAGAAGGTTCAGACCTTACGGGGTTCATAATTGACATCGAATCTGCCATGAAGGTTGCCTCCGAAGCCACAAACAGTGTGCTC
AGTGACGAACAGAAGTCACTCTACTTGTACCATGCGCTACCTGGAAAATGGAAGCAGCAACTATCGGTCTGGAAGGGTAGCAGGAAATTCATTCCCTGCG
AAGAGCTAAAGCGTCACATCGAGGCCAAGGTGCAGCATGAACTGGCGAAAAACCGCTACACGCTCAAACAAGGAACACCCGAATCGAGGGAAACTCGAAA
CGAGCAGGCCCTACAGGCTTTAGCACCTGAACCAACCTTGGTTCAAGCTCCCTATCAAGAGAGCAAGGCTCTCATCTCAACGATGAGCTGTACATACTGC
CTGCGCACCAATTACGATACTGTCGACTGCTATGTTCTACAGCGCCTCCTACAAAATGGTCAGGTAAAGGCAGGAACGGTGCTTCCCGCCAACTTTAAGC
TGAAACCTTCGTCCAATCAAGCTCGACAGCATCCTTACAAGGACGGTTTCGGCGGCAAGTCACGAAGCCAAAATCGGAATGACTACAAGAGCAAGCGGAA
CAGCAATCGAAACAGAAGCCAGAACGGCAACCAGAAGAATACATCTGGAAAATCCAAGAGTCACAATAAATTCCACGGTCGCCGCAAGGACACCGACTCC
GACAACGAGTATGGAATCATAGCCATCACCACTCTGGACCTCAGACAAGAAACAGAGGCTGTAAGTCTCACCGCCCAAGATGCGGAGCATGACCCAGTGT
GGACTGTCGACTCAGGCTGCACTCGCCACGTTACGTCCAATCCGAAGTGGTTTGAGAAGCTGATCCCAAGTGCTGGCAAGTCAATCACTGTCGGCGGCAA
TCACCAGATTCCGATAAAAGGAACTGGTGATGTCAAGATGACAATCAAGGACACGAAGGGAAAGGAACGAGAAATATCCTTGGCCAACGTGCTATATGCG
CCCCAGCTGAAGTTCAACCTACTCTCCGTGCGCCAAGCCGTCGAAGATGATTTCAAAATCAACTTCCCTAACGCCAAGAAGTGCGTTCTGTTCTTCGCTA
GCCGAACCAAATTTGAAGCTAAAATTGGTGAAGGGACTCGACTCTACCAGTTTCAAGCGAGCCCGGCAACCTCAAGTCAGGTAGCCCATGTGGCCACTTC
AGGTAAGCCTGATAATGTTTTACTTTGGCATAAACGAATGGGTCATCCTAACTTTCGCATTATGCAGGATCTGGCTAAAGCCAACACTGTCATGGACATG
GGCCTGAAGGACTTTGATTCCAAGAAAGACTACTTTTGCTCTTCCTGCACATACGCCAAGGCCCATCGTAACCCATTCAATAAACGTACCGTTGAACGGG
CAAAGTTCCCTCTTGAAAAAGTTCATTCTGATATGGCTGGTCCATTACCCGTCCCCACACTCTCGGGGTGTCAATATTTTCTGACCTTTATAGATGACTA
CTCACGGTACATGTTCATCTACATCATCAAGCGAAAGTCTGAGCTGTACGAATGCTATGAAGAATTCGCAAGAAAGCACAAAACGTTTTTCGCGCTGATG
TAGGCGAACTCCAGTTCAATGAGAACATACACGATGAAGAAGTTAGACATCTTCAAAGCGACAATGCCCGAGAATATGAGAAACTTGGAAAAATGATTTT
TCAGAAGTACAATACGCACGCACAATTTACAAATGCGTACACGCCCCAGCAAAATGGAGTTGCAGAGAGGCGCATGCGTACACTACTCGAGCGAACCAGG
GCTTTCCTCATTGATGGTAACCTACCGCAGGTTCTTTGGGGAGAATGCGTCAAACACGTTGCTGACCTTCTGAACATTACTCCCAGCTCGGTAACCGATA
AGGTCACCCCATACGAGAAATGGTTCAAGCGAAAACCATCCGCGCACTACATCAAAGTGTTTGGGTGTACTGCGTACGCTCACATCCCTGAGATACACCG
CACAAAACTAGAACCACGTGCTAAGAAGTGCATGTACTTAGGACTCCCATCAAACAAAAAGGGATATAGACTCCTTGACACGAAAGAAAACCGTGTTATC
TACAGCAGGGATGTTGTGTTTAGAGAAGACGAGTTCCCACACTTGGAATTCCTCAATACACCAGCAATCTCGGTCCAAAATGGCCCCGCACCGACGCTAT
CACCGTCGCTACCAACACCACAATTGCTACCTCCAATAGCCTCACTACTAAAACGCAGCGTCAATGCGCTTGCCGCGGAAGTAGTAGTAAAGATGAAGAA
AGTCAAACACAAAACGAACGCTCAGAACGAGGATGAACACTCGTGTCTACTTGATGATCCACTCGACATTAACGAACGAAAAGAGCACCTCACTCATATC
TACGCTCTATTGGCTATCAGACACATATCTGAACCAAAGCCGTTCCTAGAATCCCAGAAACTACCAGAAGCACAACACTGGGAGAAGGCAGCCATTTGTG
AATACAAATCATTGATTGACAACAAAACGTGGGTCCTCACAAAACTACCGACAGGGAGAAGGGCCCTACAGTGTCGATGGGTATTCGTTGTAAAATACAA
TGGAGACGGAAGTATTGAGCGCTATAAAGCCCGCCTGGTAATAAAAGGTTTTTTGCAAAAGTATGGCGTTGACTACGATGAGATATTCTCTCCAGTGATC
CGCATGGAAGTGCTGCGACTTTTACTGACGATTGCAGCACTCCTTGACCTTGAGATCCATCAAATGGATGTTAAAACCGCTTTCCTGAACGGATACCTCG
ATGAGGAAATTTACATGCTGCAACCTGAAGGGTTTACTGTTCGTGGAAAAGAGCACTTAGTCTGCAAGCTTTTGAAGAGCCTATATGGTCTCAAGCAGGC
ACCTCGGATCTGGTATCTTACCTTGTGCTCTTTTCTTCTCACCATGAAATTCCACAAACTCATCAAAGACCAATGCGTTTTCATTGGAGTTGTGGATGGA
GCTACATGCTACATTCTAGTCTATGTGGACGACCTCCTCATCATAGCCACTACGCTTGATATCATTAACAACATAAAGAACGCTCTCAAGCAGCGCTTCA
AAATGTCTGATCTCGGTGAAGCTCAATACATCTTAGGCTGGTCAATCATACGCAACCGTACGGACCGAACCATTTTCATCCACCAAGAGAAGTACGCTAC
CAAAGTCCTGGATCGCTTCTCTCATCTTGATGCACACCCGGTTGGTACACCCGCTGATCCCAGTGTGAAGCTGACGGAGGCCATGTGCCCCCAAACGCCA
GAAGAAAAACATGAGATGAAAGCGATCCCGTACAGAGAGGCAGTTGGTAGCTTCATGTACTTAATGATGGGAACTAGACCTGATCTCGCATATTTTCTAC
GAGAAGTCAGTCAATTCCTGGTGAACCCAGGAAAACCTCACTGGAATGCCGTTAAGAGAGGATTGAAGTACTTAAACGGTACGCGCAATCTTGGCATCAC
CCTTGGTGGAAAGCAAAATCTAGAGCAGTATAAGTCAAAGCATTATCTCACTGCATACTCCGACGCAGACTACGCCAATTGCCCAGAGACACGACGATCT
GTGGGAGGCTATATCGCATATATGTGTGGAAGCCCAATTTCATGGCAATCGAGAAAGCACCACACCGTAGTTCTGTCCACAACAGAGGCAGAATACATAG
CCCTATGTCACTGCATGCAAGAAGTTATTTTCTTAAAGCTTCTTTTAGTAGAGCTTAAACACGAAAGCTCACATGCTATCACCCTATTTGAGGACAATCA
AAGTTGTATTAAACTTTCCTACAACCCAGAACTGCATGGCAGAAGCAAGCACATTGACATTCGGTATCACTTTGTACAAGAAAAAGTAGAGCGAAAAGAA
TTTGAAATTATGTACTGCAACACCAAAGAAATGGTAGCAGACATTTTTACAAAAGCACTATCAAAACCCCTTTTTATAAATCTAAGAGGGTCACTATGTA
AGACACATATACAAAAATAAGAAAAAGAAAAAAAGGAAAAGAA