Description :
From Genome Similarity Track
Location :
Scaffold_311:6372- 8562
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_311-fgenesh-gene-0.1Mitochondrial Carrier (MC) Family
Pytiw_DAOMBR242034maker-piw_contig_311-fgenesh-gene-0.6Conserved gene of unknown function

Sequence
2190 bases(100 bases per row)
GTGGCGGAGTCGGCGCCACTCCAGGTCGCGGCAGTCATGTCGGCGCAGACCGCGCGCTTCCTGGCTGGCGGGCTCGCCTCAGCCACGGCCGAGATCTTCA
CGCTGCCGATCGACTGCACCAAGGTGCGGCTGCAGGCGCAGCGCGCTGTGTCCATGCCCGTGCTCACGAGCGCCGGCGTCGTCACGGCACGCCAGGAGGT
CCACTACACCGGCATGGTCGACGCGGTGCAGAAGATCGTCAAGGAGGAGGGCGCCGGCGCGCTCTGGAAGGGCGCGACGCCCGCGCTGCTGCGCCAGGTA
TCGTACACGAGCATGTGCATGGTGCTTTACGAGCCGCTGCGCGACTTGTTTGGCGCCAACAGCGCCAACAAGAGCGAGGTGCCCTTCGTGAACCGCTTTC
TCGCCGGCGGCTTTGCTGGCGCGATCGGCATCAGTTTCGCGAACCCGTACGTCACTTGGCTTTCTTGTCTTGTACCTCCCATTATCGTCCAACACACTGG
CCGCTTTAGTGGTCGTCACTGTTTGCGCATATCGGGTTTCTGATAATTATGTGTGTGCTACTTTGTTGAATGTGTGAGCGCAGAGTGGATGTGATCAAAG
TGCGCATGCAGGCGGACCGCACGGGCACGCTCTATCGCGGCGTGGGCGACGCGGTCGCCAAGATTTACCAGCGCGAGGGCATGCGCGGCTTTTTGAGGGT
ACGTTCCGCTGGCTGGTATCGGATATGTCCCTATAATGCAATGTATTGACTGGGTGTGATCATTATGATTGTAGGGCATGCCGCCGAACATCCAGCGCGG
CTTCATCGTGAACGCGGCGGAGCTCGGCACATACGACCACAGCAAGGAGTGGCTAGTGACGTCGGGCATCTTCCGCGAGGGCGTGTTTGCGCACACGGGC
GCGAGTTTCATCGCGGGCTTTGCCGGCGCCGCGGCCTCCAATCCGTACGTGCTCCCATGATATTACCTGGCCATGTTGAAAAAGAAATGCTTACCGCGTA
TATGTTGCTCTAAACAGGATCGACGTGATCAAGACGCGGCTAATGAGTCAGCCGACGAACGCCACGGGCAAAGGCGCGCTGTACGCTGGCATGGGCGACT
GCGCCAAGCAGACGTTCCAGGAGGGCGGCGTGCAGGCCTTTTACAAGGGCTTCATCCCCAACTGGATGCGCAAGGCGCCGTGGTGCATCATCTTCTTCGT
CACGTACGAAAAGTACCGAGCAGCGATCTGTGAGCAGCCTTGAAACATGGGAAGGAAATGAGCGCATGGGCGCGCAATTATATAAAAGAGAAGAAAAAAA
CATCCATGGCCTTAAATATCGTCTTGTACTTGTCAGCTTACACGCTGCGTTGTTTACTAGGAGGCGCTGCGATACTCTCTCTTCTTCTCTTTCCATCTCT
CTCTCTCTTAAACTAGAAAAAATAAAATCTTGACAAATAATTACGAATTAGCAATGCAGCGCCTCAAAGTCGCGCATCTGGATGCACCAGGTCGAGCGCG
GCGGCGTGAGGTGGCACACATGCTGGTCTTTGAGCTCGAGCTGGAGCTCAAGCGCCTCCTCGAGCTGCTCACTCAGGTCAATATACTCAGACGTGTGCAT
GACGTTGAGCTTCGGGTTGTCGGCCGGCGACGAGACCTTGCCGTCCTTGGGCAGCAGCACGATGGGCAACCGCTGCGGGTCCTCCTTCGCCCATCGATCG
CGCGAGATCACGTGCACGCTGTAGCGCGAGAATGAGCCACTCATCATGCGGTTCGAAATCGTGCTCTCCACGGATGGTGCGCGGGGCTCCTCGTCCTCGT
CCTCGTCCTCGACGCAGTAGTACGCCGGTCGTCGGCGCCGCTGGCCCACGCCGCTGCCTTTCGAGAACAGCAGGTGACGGAAATGCTCGCGCTCGCGTCG
TCGGGACTCGAGGATCTCTTCGCGCGAGTTTGAGTTCGAGCGGCTCCATAGACTCGAGCCCATGCTGCTGGTGTTGGTGGTGTTGTTACTCTGCTGCACG
TTCGTGGTCGTGCTTGGATTTGAGCTCGTACTGCTACTTGCGTGGATCACGTGCGTGTTGAGGCTGACCGGCGCGACTTGGCTCAGACGGTTGCCCTCCA
TGTTCATCAAGAGCTTCTGCAGCGCCAGGAAAGTCTCGTCCACCTCGTCGTCCTCGTCCTCGGTGTCGTCCTCGGGCTCGAGCACCGGCG