Description :
From Genome Similarity Track
Location :
Scaffold_248:6372- 8087
Sequence
1715 bases(100 bases per row)
CGAGAACTATCTACTGTAATCAGCGAGACTATGATGAAGTATTGACTACTCGCGATCACGATGGTACGATGGCCAGCATTAAGTTTTTAATAGTGTAGAT
GTCTTGGAGCTTTGGTAGGATGTAGCTGCTCATGGGTGTGGGTTCGTCTGTCCCTCTTACTCCTCTCTTTTCAATCCAATGGAAGGCCGCTAAAATACCT
CTTGTGAGAGCTAATAAGCACCGTCTGTGAACCCTTCACAAATACCATTGCGAAATCCGATGAATCCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGGTGGATTCGAGATCAAGTCTAAAAGTTTGCTCTGCGTGATGCAGAGGGGTTAATAAATCAGGCACAATCCAAGCGCTGTCAAAGCGTTA
TCCATTTCGATCTATGTTTATATGTTGTCGATATGAAATCACGAGCAATGTTTTGTCTTTTTTGCAGAAATCGCTAGGTAGATGCAGCCTTTTGTAAAGG
ACCTTGTCAGGTGCTCTGAACGGTCAAGTCAGGCGGCAGGTGCATTCTACTGTTGAACTGGTTTAAAATACTCCTCCCCCATTGGCTTTTTTAATATTTC
TCTCTTTCCAATCTCTTCTCGCAGCTTCATGCGTTCAATCGCACAACTAGCTGCACCATCCTATCGGTCTTCATTGCAGCATCTTCAAGACGCTCAGCGT
TTCGAAGCGGTATCCAAATGCTAAATGCCTCACTTCTGACGCATCTGCATCATTACGTGTTCTACCAGTCACTGATCATCAAGGAGAGCGGTGGTAAGGG
CTCAATTAAGTCTTTCGAATCCCGATCTGTGCGCAATCGACTTCTTGCAGCCCTCGCAATATTTTGTAAAATAGTTAGCATTTATCAAATCATAACACCA
GCATCCTTGTAGATCTGCGCTTAAAAACCCTGTGCTATTCTGCGGCTGCACTTGACGAAGTTCCTGTTCTGTTCAACATCGTCTAGGTTCGTTACGTTCC
CGATGGATTTTTGTTCGCTGCCCTTCATTATATCAAAAGCAAGCCGTTACATTGAATGTTGCCTTTGATGTGTAGTGCCTGAAGCATTGACAACAAACCT
GTCATCACGCGAGAAGATACGTGGTTAGCATCGTACATAGCTTGTGAAGGGCATTATTCTACTAAAAGTACGATCTATTTCAACCGTAGTAACGCATTCT
GACACCATAACGGCTCACAATAGTTCTAGTTTTTAAATAGCATATTGCTCTTGATGTGATACGTGTCGTGGGATTGGTATATTAGGGTGTGTATAAACAG
CAATTATAGTCTGTGAAAGTATGACGTGTAAAATTTCTGTGAGTACAAACAAAAAAAATCTGCTGAGAAGATTTTGTCGTCTCCACCGATTTTTGAGTGT
TCACGATCATCATTCGGGAAGGTCACAGACGGTTTTTGTGTAAACGCTCACAAATAGGGATTTGGTGGCCTTTGTGGTACAGTAGTTTGTCGAATCTGTA
TCAGTACACCATCAA