Description :
From Genome Similarity Track
Location :
Scaffold_1188:6371- 8720
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1188-snap-gene-0.6Flagellar radial spoke protein
Pytir_DAOMBR486maker-pir_contig_1188-fgenesh-gene-0.3RRNA 2'-O-methyltransferase fibrillarin

Sequence
2349 bases(100 bases per row)
CGATGCTCGAGTTCTTTCGAACCGACGGGTTCTTGTGCTTGAGGCACGCGACCAGCGGCTCAACGCCAAACTCGATCACTCGCGGCTTGGCGTCTTCGTA
GGTGGAGAGTCCCATGACTGCGCCGATTAGCACGCGCGTGAGCTCTACTTGGGCGTTCTCATCGTCGGATTTGATCGACTGCGGAAGCACCAGCTTCGAG
AGAACTTTGAGGCAGATCTCGACTGCGTCCAGGTGGATCGCCTCGCGCTTGCCCTGGTCATGGGTCGCAGCGTTACTGATGATGAGCGCAGCGTGCAGAA
GCGTCTTTGAAGGATAGAGGATTGATTGCTTCAGGATCTCGAGCACGGGAGTGATGATCGGGAATTGCGTGCACACGCTCGCGCCTTTGAACACGCGTGT
CAGGCTGGCCAGAATCTCCATCGCGAGGCTGAGGATGGACTCTGGGACCTTCTTCACCGGTTGGCTCGTGAGAATGAGTGTGATCTTCTCCACGACGTCA
TCGCGCTTGGCGATGAGTAGCACGCCCTCGCTCGAGATCGACAGGTTGCGGAAAATGGTACACGCTGCCGCGATGACGGATTCCTCCGGACCGTCCAGCA
GATTCGTAGCTGCTCGAAGCATCGTGCCATTGCTCAACTCGTCAGCTTTGTCCTGTGATACAATCCGAATGGTGGTGAGTACCTACATCGGTTGCATCTC
GGTACTCGAAGTAGTGTTCATAGCATGGAGTCTTACATTTTCATAGAGAACGAGCGAGGAGATCACCAGCGCTGCGTTCCTTCGCACGTTGCTCGAGCGG
GACTCTGTCAGATCTGCACACGAGAAGAGCACCTCGTGGATACCCGCAGTGTATTTCGTCTCCTGTAGAGGCATGAAAGTGTCAACGACAATGTTGGCTA
CAGAGAGCTATAAGAACTGGGCTACAGAGTCTTGTCAACAGGTACCTGGTTACTCAGAAGTTCGTAGAGCTCCTGGAGCGCCTTTGCGCGGCCTTCGTCG
TTGAGGTCGTCCATGAGCAAGAGCTCGGCGTACTTGGGCACCGCTCGCAACCCAAACGCCCTCGTCACCTACGGCGCAATTGCAAGAACAAGGGAAATTG
GTCACAAAGCATGATCTAAAATATGAAGAGTGCAAGGTTCAGCGGGATCATTAGTCGCACTATGGTTTTGGCACCTATTTAATGCAATACCTCTTTCGGG
TTGTACGAGTCCTTGAAAGGCAGGTCCTGGTACGGGTGGCGCTCATTGAGATGATCACTAGACGGAAGAACACCAAGCAGTCAGACAACGTACGCCACAG
TCATCCACAGAGCTCACTCATTTGCACAAGTACCTGACGCTGTGCATGGTGGTGTTGGGTTAGTGAAATGGAGACAGAAAGAGAGCCAAGGTGGTGGAGG
CAACGATAAACCAAGCTAAATTGCAAGTTGAGCTTGGACTTGCTGTCCACTTGCCTATTCTTGGCGAAGCGAATCGGAAAAACGGATGCAGAGCTATGGA
ACCACAGAGCAAATGTGATGAGTGAATAATAGTTGAAACGATGGAACTCTATTCGATTTACATGAAACAAGCGCGTAGTCGGTTCCCTCCCACACAAAGA
TCTGAACAGCCTACAGCTACTCTACCAGACTCAATAGACTACAGGCAAGACTCACTCACGTGCGCGTGCTTGGGCTTGGACTCTGGTGCGTGTGGCTAGA
ATCGCGTTCTCTCTCTTTCTTGCTGCGGTTTCTCTCATTGACCTCCCGGAGGAGGCGGTAGACGTCTATCAGTCACAGAGCCACCAACATTTCTGCGGGT
AGCGGTTTGTTCAGTCCGCCCGACGCAATGTTTCTAATCATCGAGAAGCGCGATGAAGAGAGAGAGAGAGAGCGATCTCCAGCACCAGCTCACAGCACGC
CGTCCAGCTGACGCCAAGCAGCACGCACGCGAGTCGTTGTTGTCTTGTTCTTCTTGGATCGACTAGCTGTTCTTGTGGTACTTGTTTGTCTGAGGAACTA
CTTGAGGGAATGAGTGGGTGGGGAACTGAAAGTGGGGTGGGGAGGGAACCTACAGACAAACAGGAGAACAGTTAGGGGGTCAACGAGATCTCATTCCAAC
TGGCATAAATTAGAACACACGTGTGCGGTTCTTAGCTGGCGCTCTGCCCGACACATGCTAGCTGGCCCTATCATTTTTTCTTCTTCATCTCACATGCCGA
GCAAGCCAAACATGCAATATACAAAAAAATATGAAGGGCATATCTATGAATATGGCTCCCGTGCAATCCATGCGTGTTTCAGCACGGATCAAGAAGAGAC
AAGGCAGCAAAACTGGTTTACTTCTTGTCCTTCTTTGGGGCGCGGTAGG