Description :
From Genome Similarity Track
Location :
scaffold_136:63708- 65000
Transcript NameFunction/comments
g4378.t1 hypothetical protein PHYSODRAFT_528617

Sequence
1292 bases(100 bases per row)
GACCACAAATTGTACGATGATGCCAAAAGCGTGCAGACCTGGCATGGTAATCTCCGAGTATGGTAGCGTCACAACCCTGTGTCATGATAGAATTACACAA
ACGTTAGTTTGAGGCGGAACAGCAAAAGCTGATGCAGGTAACTACCAGAAGAAGACGAAGGCCACGACGGTGGAGGTGGTTGAGCCTTCAAAGAAGACCC
AGTCCAGGATTTCCCACGAGCAAGCTGATGGGCGTCGGTAGTGCAGCAGTATACGAGGACCATTGAACGTAGGCTGGTACAGATGTACCGCAGCAATCTA
CACAAAGCAACAGCAAAATAAGGATTAATTCCAACACCAATTTGTTGACACCCCATTTTCAGGTATCAAGGTTTTCTTACCCACATGGCAATGACGGAAT
ACAGCGCCGACATGGGTCCAAACATCATTAGTGGAGGTATCTTCTCACGGCCATTGTTATAAAAACCTTCCCACGCCAACAACAGGCTCTGGAAGAAAAC
GCTACAGACAAATCTGTTTACAATGAGAAAAAAAGCTATCAGCATTTAGCTACCAGACCATTTTGAGATATGCATACACAAATAAAAAGTAGAAGACATT
CATACATGCCGAGCGCGCCCATGAGCTTCCAGCCGACACGCTGGTTACGTGTAAAGTGCGACAGCTTCGTGTGTCTCGTGAGGTGGTACGGACTTTTGCC
TTTGAAGAAGTTGAAACAGTCATCCCAGGCGTCCAGGCAGTCCGCGGACGCCATGTCGGCTGACGGAGGCCTCTGCCTTGTGTCTAGAGGCTTCGTTCTC
GCTGGAAGGTGCTGCGAAGACGAACTTCGAGCGTCGTGGAGTGTCGGCGTTGAGTGCCTTTTGTCAATGCCGCCACTTGCAGTTTAGTTTCGGCCAATAA
GATTAATCAGACTATATAACAAAAAAATGTGATGATATTTGCTCTGCTTCTTTTTGCATTTCACAGACTATATAACAAAATTCGTGACACATACCTTTTT
TAGTCGTGGCAAAATATGTTGATGCTTTTTTATGCATTGATAGTGCTGTTGTTGCACTTCGCTAGTCGAAGCTAAAGCCAAAACCGAAGGAACTCGGTGC
TACAACTTCACTAGATGAAGAGGGAGACGCTTCTTTCGAATTGTCATCCCCGTGGATGAGCAGTTCCCACTTGGATTTCCGGTGCTTGCGTTCGTATTCG
TCCCTGAGCTCTTTGTCCACCTTGGCGTAGAGCTCAGGGGCATTCTTAGCCATCACCTCTCTGAACATTCCATCCAACATGGGGCGTTGCTC