Description :
From Genome Similarity Track
Location :
Scaffold_98:63703- 73472
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18991nucleolar GTP-binding protein 2
Phypa_INRA-310PPTG_18992hypothetical protein
Phypa_INRA-310PPTG_18993nardilysin-like protein
Phypa_INRA-310PPTG_18994voltage-gated Ion Channel (VIC) superfamily
Phypa_INRA-310PPTG_1899540S ribosomal protein S15a

Sequence
9769 bases(100 bases per row)
AATAGCATGCATATCCAATCATTTCTGCTTGTCCTCCTCCTGACTATCGCCGTCCTTCTCAGCGCTTTCCTCGTCCTCCTCTACTTTCTCATCATCGTCG
AGCTCCACCTCATCCTCGCCAGCCTCGGCCTCGTTGAGCGGAGCGTCGTCACCCTTTTGCTCAAGAGCAGCGAGCTCCTCTGCACGCATGGGTGGAGCGA
TGAACCAGGGCAGCTTGCCACGCTGGTAGTCGTTGATCATCTGCACGGCGACGTTGTTGTAGTCGGGCTCACCCTTCTGCAGCAGCTTACCACACTTATT
GGCGAGTTTCTCCAGGAAATCCCACTCGTCATTCCACTCCTCAATGCCGTACACTTTGACAATAAACTCCTTCTTGACTCGCTGTAAGATGGTCAGGATG
AAGTCCGTGGGCTGAGGCAGACGCTCAGCACGAACGACACCCTTGAGCACAGTCTCAACCTCGTCATCACCCGTGTCATACACGATACCGGGGCAATCAA
TCAGGAAGATGCGGCGCATGAGCGTGATGTACTGCCACACCTTGGTCTCACCCGGGATCGGAGCCACCTTGCACACCTTCTTCTTACGCAATGCGTTGAT
TACCGAACTCTTGCCCACGTTCGGGTAGCCAATGAGACCCACAGAGATCTGCTTCTTCTCCTGGTGCAGCTTTGCGAACTGACGCAGGAGGTTAATCAGC
GCACCCTTGCCGAACGGGTTGCTCATGGACGCGTGGAAAGCAAGCGTAGGCGTCGTCTCGCTGAGCTTTTGCACCCAGCGCTTGGTGACCCAGTTGGGCA
CCAGGTCGCACTTGTTAATGACAAAGATTAGGTGCTTGTGCGAGGCGTTCTTGCGGATGTGCTTCTCCACGTGCTCGCAACGGGTACCAGGAACGTTGCG
GGCGTCCAGCACTTGGATAACGACGTCCGAGCAGTCCAGCACCTTGTAGAGCTCGCCCCAAATACGCTTGGACTGGCCCTTGTTGAACACATCGTGCGAG
ACCTCTTCCTTGAACTCCTGTTCCACGGTAATGTTGCGATCCGGGCCCTTAGCTTCGTACTTCTCTGCATTCTCCTGCGCTCTGGAGACCAGCGACGCGT
AGTCCGTGGCTGCAATCTTGGCACGTTTGCGGCTGCGCTTGCCGTTGAAGACCTCGTCGTAGCTCTCGGTCTCCAGAAGTTTCATACGCGTCGTCTTCTC
GCTCTCTTGTAGCAGACCCATAGGCAGCTTACGCGTACGCAGCACCACCGAGTACGGGTCGGCGGCCTTGAGGGACATTTCGTTGCGGAACTTGTCCAGC
TCCTTCTGTCCCACCACGCGCGTGTTACCGAACCAGCGGCGGTCAGGCTGCACGCGGCCACTAGCGCTGGTGATCTCCTGTCCTCCAGCCTTGTTCTTCA
TCATGAGACTACCGCCCACGACCTTGCCGGCCTTGTTGCGGATGGGGCCGCTGTTGCGATACATGTTGAGGCGCTTGATGGTGCTCTTGTCACGCATGTT
GGCCGCCTTCTGCCGCTTGGGGATCTTGCGGTTTGGGTTGTCGGCTGACGCCTTAGTCGTGTTGATACCCTTCGCCATGGCTCTCGTCTTAGATGCTGCA
GAGCGAGGTCAGATACGTGCTCGGCGTGACAGCAATTCCCTAGCGCAAAATGACAGCAAAAGCAGACAACGACCGTTGGAACGATTGGGCATCAACCGCG
CAATTTTCCGCCAATGGAAGACTGAATTTAAACTGGCTTTCTACCAATCATGCATTACTGAGTATTTGATGACAGCGCTGCGTCAGGCTCCATTTCCGTT
ATTTACAGCATAGTCTTAACTTTATCTGGCGCTCATATAGAAAGTCGTCTTTGATAACAACACAAAGTATCCTCTTTTTACAATTGCAGCCCTGTATTCC
AGCTGCAAATCGTTCTTCATCAGACGCAGACTGCATCCGTTGTCAGCCATGACAACCATGGCGCTCGCAGCACAGCAGCACCACGAGCGCGCCGAGATGG
CTTCGTATCTGTACGAAAAGCACCTAAATCACCAGGATGGCGTAGCTGGCACGCTGAGCATCCGCCTGGTGGCAGCTCGCAACCTTCGCGCCGCCGCTTC
CATGTTCTGGGTGCGAACATGCAACCCGTACGTGATCTTCCGCGTTGGAAAGCAGAGCGTTCGCAGCGCCACCATTCCAAGTAACGATAACCCAACGTGG
CGCCGCGAGCTACTCGAGGTGAAGCTGCCCAAGTTGGACCACAAGCGCCACCCTCTGGGCGAGCACTCGGATGTGAGGATGGAGCTGATCGTTGACGCAA
TGAACGAAGACTCGCTCACCGGTAAGGCCACAGAGGCCGTGGGTATGGCCAATGGGTCTGTAATCGGCACAGCCGCCGTGGACTTTACGCCGCTTATTGA
GGGCAAGGAAGACGTCATGGACCAGTGGATCCCACTCAGTGGTGCGCTTCCCATGGCTGCCGCTACTGGAGGAGCGACAGCCGTCAAGAAGCAGCAGGCT
GAAGCAGAACTGAGCTTGGGTGAGGTTCGTATCGTGCTGCAGTACGAGCCGCACGGCATGGAGCCGCGTGTGGGTGACGTGGTGAAGTTCGAAGGTTTAG
GCTCCTACCCGTCAGCGGTGCTCGGTCCCGTGGAAGAATTAGAGCTACATGTGAAGAAGACGAGCGGCAGTTATTTGCTGTGCAGCTACACGACTCAGTC
TGGCTATGAAGCTACGTTACGCGTGCATCGCAACAACGTCTTCGTTGCACATCGCGGCAGCTTTTTCGACCGCTTCTACGAGTCGTTCGTCGTCGAGCCA
CTGGAGTTCGTAGGTAGCACACCCATCGGCCAGTCTGCCAAGGAAGTGCTGCGTCCGTATATGAATGTGGCTCGTGCATTCAGCGGCCCAGCCCTGGTGG
CGACGAAAGCTACACTCATGACGACGTACCGTGCGTCTACGGCAGCTATCGGTGCGGTGGTGGCATCTCTCGACGAGTAGAACCCGTGACATATGTAGCT
CAGAGAGGCAAGAAATAGGCAAGGCACAGTAATGAGTCAATGATAAGTATGAATGAGCCTGCATTTGATCAAGCAAATATGTACGATGGCAATTCTACTG
ACAAATGCGATTCTATTGAACAATTGATTGATTTCGGTAGTCGCAGGTGATTGGCGAATACTGAAACATATGTAGTCACAGACTTGAAGGCAGCATCAAG
GACGTTGACAAGGTTTTGAGACAATGCTGGGTGCATTTGTGGAGAGCTGTAGCTCTCCCCGGCTTATTCACATCGCAATCGAACAGGGGGCCGCGTTGAG
GAAGTTGCTGAGATGACGTCGCCGCTGTCTTCTCGTATGAGTCTGGACAGCTTCCGGTCGCCCGCAGACAAGAAGAGCTACCGTCTCATCACTCTGTCCA
ATGGACTGGAGGTTCTGCTCGTCCAGAGCGATGCTAGTCCAGTCAATCGATCAACATTCGACTGTAATGACGATGGCAATGATCTGGACAGTCTCAGCTC
GACGGATGACACGGGCTTTGACGAAGAAGGAGACGAGATCAACGATCGAGCTCCAACATTGGCCGCAGCGTGTCTGACAGTAGATGTGGGCAGTCTGGCC
GATCCGGAAGACTTGCCAGGTCTAGCACACTATTTTGAGCACATGATCTTCATGGGTAGTGAGAAGTATCCAGCTGAGGACGCATTTGAAAGCTTTTTAA
GTGCACACGGAGGGTCCAGCAACGGAGCGACAGAGTGCGAGTCTACGAGGTTCGTGTTTGATGTGGATGCTGCTTACTTGGCACCAGCACTTGATATTTT
CGCGAATCTTTTTGTGGCCCCGATATTACGACGTGAAGCGATGGAACGCGAGCTGAAAGCAGTTGAGTCCGAGTTTCAGCGGATGAGGAACAATAATTCT
GTCCGTTTGCAGCAAGTTATGTGCGAGACAAGTGTTCCAGAGCACCCATACTCGCGCTGCTTTACGTGGGGCAATGTGGAAAGTTTGAAACACAATCCAG
AACGCGATGGAATCAACGTTCGTGAACAAATGCTTCAGTTATTCAATAAGTTCTACGTGGCTCCAGCAATGAAGCTATGTGTGTATGGGTGTGAATCACT
AGATGTATTGGAACAATACGTGACTCAGAGCTTCAGTGATATTCCAGCCTATCGGGGCAGCTACGATAAACCTAGGTCTGAGACCCTGACGGTGCCTTAC
GGTGGTGGAGCAGGTCAGAAGCCCACGGTCTTACACGTCATTCCAGTAGGAGAGAAGTGCTCGATTCGCTTGTATTGGATGCTTCCACCAATGATGAAGA
ACTACCGGCAGAAGCCTTGGTTATATGTGGGTCACTTGTTGGGCCACGAAAGCCCAGAGTCTATTGCTTCATTGCTTAAACAAAGACAGTGGGCTACCGA
CATCATTGCCGGCACCTCTGATCGAGATGGCTACGAGTTTGGGTCGTTTGGTACGGTTTTTGAGGTCCGGATATCTCTCACCGAACAAGGTCTGGCGTGC
TGGGAACAGGTTGTTCAAGTCATTTTTGATGCTCTTCATATCTTTTCATCTCTAGCAGCAGCCGGCGATTTACCTGCTTGTGTGTTTGAAGAACTCCACT
CGTCTAGCGAGATGGACTTTCGATTCCAAGAAGATGACATCGCACCCGTGACTTTATGCCGTGAGCTCAGTGAAAGGATGCTGCCTCGCCACAATATTCA
ACAGCATTGCGAGGGAGATTTATTGCGCTATGATCTCATACAGGGTGGATTCGACATTTCATCTGTATACTCGCTACTATCCGGGCTTTCGGCTAACAAT
GTCCGTGCCGTCTTAGTGGCGTCTTCATTTGCCGACACTCTCAACCCAAATGATCTCCAGACTGAGCGATGGTTTGGTACCAAGTACACTGTAAATTCAA
TTCCTGAATCAGTGATTGCAGCTTGGTCGCAGCTTTCGAATGAATCGATCGAACTGTCGGTCTTGCCAACACCGAATCCATTCATGCCTCGAAACTTCTC
AGTATTGCCGTTGGAACCGGTTATTCAAGTTGATAATGACACTCCTCCGGACCTCATCCTCACAACGTCAACTACACAGCTCTGGTACAAACGCGATCGC
AAATTTTTGGTGCCCAAAGCGAGTGTCAGCTTCCTCGTGACGCTACCAGAACCAACAGCAGCGATTCATATGCTCGCAGAGTTGCATGTCGAGTTGGTTA
GACGCCGTTTGCAGCACACGTTAGAGCAAGCTGAGACTGCAAGTTTTACTACCGAGTTGGACGTAAGGGACGAAGCTATTGAGGTGGTGATCTCCGGATT
CAGTGACATGTTGCCGTCGCTGGTTGTTGTCATTATGCGAGAGGTTTTGCGTCCGTCCACGACATTTGATATTGAATCGGAATTAACGTTAGCGCGAGGT
GAACTCGAACGTGAGTACCGCAATGCTACATTATCTCCAAGAGCAAAAGCTTACGAGTTACGCTTGCAGATGCTAGAGAGCAGAGCTGTCACTACGGACG
ACAAGTTGGAAGCACTTCAAAGCAAATATGGACATGAGAGTGACCTTGCAGCTGATCTCGCACACTTAACGGTCTCCGTTCTCGGATGCAGTAAAGATAC
ACCGGTGATACGCTGCATGGTGATCGGCAACATGAGTCGGGAAGCTGCTGTTTCACTCGTTCTGGACGTTGAAGCTGTCAAAACTGGAGATTCTTCCTTG
CTACCCTGTGAACCAGAACCAGAGCTTGAACCAGAGCCCCCGATATTGGCTCCAAGATGCCACACGATAGCTCTACCACCGACAACCAATGGTCTACTAG
TACGTCGTGATAGTGAACGCATTGGAGAGCGGAATTCCGTGGTCGAAGTGTATTTCCAGATCGGCAAAGTCGGACCGACAGATCGAGCGTACGCTATATT
ATTGCGCTCTCTACTGGCCCAGCCACTCTTCCACGAATTGCGAACCAAGCAGCAACTGGGGTATACTGTGACTTGCAGTATTCGAGACACACACGGTGTA
CTCGGACTGAATCTGAGCGTACAGTCAGCCTCGCATGCTGCCGGTGCCGTGGCCAAGAAGCTCGATGTCTTTTTACATGAAGAATTCCCACACGATTATC
TGCTCTCCGATGAACGCCTTTCGCCCAAACGCTTTGCAGCCTACGTCCAAACTCTGCAGCGAGCTTATGCTCGACCTGACGCAACGTTGACTGAGCAAAG
TGAACGATACTGGGAAGAGATCGTAAGTGGACGTCTGGAGTTTGACTTGGATGCGCGAGTAGCGACTGCTCTTGGTGACTGTACGCGTCAAGGTCTACTC
GAAAGGTACCAATGCTGGATACAAGGAAGCACTAGCTGCTGCAACACGTGCACTCAATCTCGTGATGGGAACCGTCAAGCTCAGCACAGGAGCAGCAAAA
GTCATGGGACACGGAAACTCCGAGTGCACGTTGTGGGCCAATGCAGTCCATTGAAGCCACTCGAGCAGCTCGTACCTCCTGGCAAAACTCCATTCATCAT
AACAGGAGACTTGCACGATTTTAAGCGCGAGCTGCGGTGCTACTGCCACTTGACGAGTGACTAAATTGAGAAATCTATTGACTAGAGAGAACGGATATCT
ACATTTCCACTGTATCCAACCTTGTCATCCTTTGCCTTGCCCATCGTTTGTTGTTTGGAACTCGAGCAACTCGGACGCTGTCACAAAGTTGTGTACGGAT
GGCCGATGTGAGGCGGTGGCGCTTACACGTCGTAAACGCGGTGAAGGGGGATTACTACCAGCAGTTGGTCCATCATCGCTCGTCTTTAATGCACGAAGAA
GGAGGTTTCGTGTGGAACTCCGAGTCCTCGACATCTCCTTCAATGCATCGGACACTACTAGACGCTTCTCAAGGTTCATTATTCGACTTTCGAGGCTTTC
AGAGTGTGCGTGCATACGAGCTTTCATGACTTCCACTTCTCCTGATACTCGAGATACTTGCTCCAGGAGACTTTGAAGTGTCAACTCCAGCATTACGGCC
CAAGGCGGAACATTTTCGGACGATGAGGTAGCGGCTTGGGTAGAACTAGAGCCAACGTTAGGTGCCTCGTTGGCTGTAGAATTACTGGGTATTTCTTGTG
AGGTTGGTGCCTCCTGTCGAGGCTGATATGATTGTTGTTGAGGCTGTCGAAGTGACCACTGCAGTTGGTTCGGTTGTTGCTGTAGCTGTTGTAAAAGTGT
AATTGAACTGCTGGTGCTTGGTAATGATACTGAACCACCTCCCCCGCTTAATGGCGGTGATGACTCCGGGATGGTAGCGGCAGCTATTAAGTTACTAAGA
TTGCGTTTACTACGCGATCGATCTCCATTTTGGACCAAGAAAAGCTCGGACAATTCCTCAATCTTCGCGCGGATGTACTCAACGTTAACCTCCATCATTT
CCAGCATGGTCATTTGTGAATCCATGGGATCACTGACATCATGAGAGTGCACTCGTCTCTTTACTTGCCGATACTTTGCCAGCACTGTGAACAATTTGAG
CTCCGCTCGACGCAGGGCTCGTTTCGTACCGCTGGTTCCTGTCGCTTTGTCCTCATGAACCTCCGTTGTCGAAATGTTACCGTGACTACTTTCGCCTCCT
TCTAGTGAGGCAGCTCGGTTATGTCGACGTTGTGCTGCTCGAAGCTGTGCAAACGCCTGCAGTGCTCGAGCCGCATGATCATTTATTAGCCGTCGATGTT
CGTCTTTCTTGAGGAACGCATTGACTTTGTGCTCCGACCGTGTAAGTACTAAATAGTTACTCATGACTGCGATAGTCACTGCAGCGGAGAGAGTACCGAA
GACTCCGGCACTTACTGCTATGCCACGACCAAGAGTTGTGCGCGGTACGACGTCACCGTATCCGATGGTGAGAATTGTGATGATAAGCATCCAAATCGCG
TCGCCAAGTAACATGGGTTGACAGCAGGAATCCGCTTTAAAAGCACATAAGAAGCGCTCCGCCACGTACATTGAATACCCAGCAACGAACCCAAGAACAG
TAAAGCTTGTTATCAGACATGTGGTAGGATGATTCTTTAGTGTCGATTTCATGAAGAAAGTTGCGGTAAAATCGACATTAGTGAGCGCTCCAATGAACCA
TCCGTTGCTCGAATTGAACGCGTTACGGAACTGCACCACTCGAATTATGAGAATCACCCGCGTGAACATTACGAGGCTGGTGGCCACCGTTAGTTGAGGC
CATTTCGGATCCACGTCCTCAATTCCGGGGAATGGATGTACACCTAGTACGGCCATTTCAATGAGCAGCGAGTGTCGCAACGAAGAGCTCAGCAACGTCG
CCTTTGGTGGCATAATATTCTTGAGTTTCATGACTTCGCATTCTGCTGCGTAGTAGAGATAGATATAGTACAGCATGAGTGCTGTGGAGAAGGAAATAAG
CACTCGCAGTGACAGTAAAACCATCCGACCTTCGCTCACTGGTACATTTGTGTCTAAAGCCTCAAAGCAGAGCGGACACTGTGTTGTCGATTCCACCGGG
CACAAGTCGGGTAAAGTCCGTGTATTGGCGAACCACATATACTCCATCTGCAACATCATAAGTGCCAGACCACAAAAGCCGTAGAAAACCTGGAAAGCTG
TGTGTCGTCGCTGTGCTTGTACGAGTATCATCCGTCGTTCCTGTACTGACGCCATTTCTGCAGTAGTAGCTTTTGCCTTGCTGTCGAAATGTTTCATTTT
GGATTTTGGTGACACTGGTACAGTCACTACTCCCGGACCTGGTCGTGTATCTGGTTCCGAACATTCGGTAGCGGACATTGCTGCTTCCAGCGGCACGATC
TCATTCCTACTCGGCATGGTTGCTGGCTATGACACGTACGCTCCAGAAACCCACTAAGACACCGGAACTCGGCGAAGTAAAATTCGATGGCCAGACGCGC
AGGGCATTCACTTGCGCTCCGCTGGAGGTAAGAAGAAGCCCCTTGAAGCAGCCAGCGGACAGATATAACTAGCACCTGGAAGTTGTTCCTTGCCCAGCGC
CTCGCCACTTTCACGTAGTGAACTCTATTCGCTTATTTATAGGGAAGCGACTTCATGGGGTCAGTTTCAGCGACCAAACCTCCTCGCAAATATTAATAAC
CTCAGTCAACACAAGCAACCAGCAGATCGCGCGACCATATAAACTCACGGTGGAAGCCCTGAAAGCACGACGTAACGCAAAGAAGCTGCTTTATTAGCCG
AGTCTCTACGTGGTTAGAATCCACTCAAATCCTCTCCTTCCTCCCGGCACGACTACGAGGTCGCACTAGTTGGCTAGAGTCATGGTCTGGTCTCGCTAAA
GACTTAGTAGAAGAAGCCGATGATCTTGCCACCCGTGTGTTTGCGGCGGGCCTCGTGGTGGTCCATGATGCCGTACGTGGTGCTGACCACAATGTGGCCG
AACTGACGCGAGGGCAGCAGGTTGTTGATCCACTTCTCGTAGTCAGCAAGCTTGACGTCGAAGCGGGGCGAGATGACACCGCACTTGTTGATGCGGCCCT
TGAGCTCCACGACGATCTTGCCGGCACGGTGGTCGTCAACGATCTCGAACTCGCCGATGTAGCCGTTCTTCTGCATCACCTGCAGGAACTTGACGATGAC
CTTGGAGCTCGGGCGGATGAGAACCTGACGCTTGCCACGCTTCTCAGCGTTGTACATCGTCTTGAGGCAGTCGGCCAGCACGCTCATACGAACCATGGCT
GTGGAGTGGGAACAAAAGAAAAACAGAGCATTAATGCCTACTGCTAAAAGCCAAGGTCAACCGCTGCCT