Description :
From Genome Similarity Track
Location :
Scaffold_69:63702- 67766
Transcript NameFunction/comments
Physo_139006hypothetical protein
Physo_139007hypothetical protein

Sequence
4064 bases(100 bases per row)
GGTAAGGGGTTGCGTGACACGCTTGAACGTTATGGACTCTCTACATACATCAGCATTTGGGGCGCCATAGCCATTTGCTTGACCATGACTAATGTGTACC
ACACCACGTACGACCTTCCCACAACATTAATTGACTGGTTGACAATTTGAAAACACGCGGGAGCCCAGTCAACCAATCACAACTCTTCATTTCAAACATC
CTAGAAATTGTACCGCGCGAAGTGAACTAGACACCTTCAAGCTCGAGCTCTGACGTGACGGAGATACGGGACAAGACGATGGTCGCCGTCACGAGGTCAC
GCACTCACCAGAGCGCCCCTCAGTCCCCCTCCCCCAGCGCCAAGCGAGTGTGCCCCCAGCAAGAGGGCAACTACCTCCGCGCCAAGAGGCTGCTCCCATG
CGACACGGGCCTGCAGCCGTTCCGACGCCTCAAGCACGCGCGCTTCCCGGACGGAATCCTGGCGCTGCCCCATGTCCTCAAACAAGTTGACACGCTCCTC
ATGTCGCCCAAAGATGCCGTCGTTGAGGCAGCTAGGATCGGAGACGTCGACTGGCTGTGGGAGCTGTTGGGCCGCTGCAACTGCGCTACACTCGACGCCA
TGAGTGTAGCTGCTGCCAACGGTCACCTGGAAGCTGTGCACGCGCTCTACCAAGCGCATTATTGCGGGTGTCCACTCAAGGACGACGCGTGGAAAGCTGT
CAAGAAGGCGGCCATTGCTGCCACCATGGAAGGATACGTGGACATCGTCGAGTATCTACTGCAGCGGCTTGTAGACCGCGATCCAACTAGTCGCAGAGCC
GAACAGATCGGAAAGATTTTCGTGGAGGCGGCGGGGAATGGGCAACTTGGTGTCGTGAAGTTTATGGTCGGGTACGAGAAGATCAAGCGCTACGTGGCTA
TTTATGCGAGCCAGGCTCTACCTCGTGCCATCATCGCGAGGCAGGCAACTGTGGTGGATTTTCTCCTGGAACAACATGACTTTGAATGGAGCTTGCTGGA
TGCCTTTGAAGAGGCGGTCCAAGACAACCAGGCCGACACAGCGCAAAAGATTTACGAGGTGTATCCGCTGTTCCCGAACGGCAAGCTGCTCGTGGATTTA
GCCCGACAAGGGCGTCGGAGTGGCGTTGAGTACCTCTACAACAACGGGCGAAACGATCCAATAATCGTGGGGGACGCCTTCATAGCTGCCGTCTACGCAG
ATAAGCGTGACGTCGTAAGGTTTCTGCATGCTACGGGAATTGTCTCGACCGATAGTTTCCAAACGGCTTTTGAGGGCGCAATGAGGGTTTCCAACTCCAA
CACAGCTCTGTGTCTGTACAGTTTCAAGCGAGCATCTGTGCCGATGCTTAACCAGTGGTTCCAAAGTACGCGCAACGTTGAGGTGATGAGGCGGCTGATG
GAGAAAGAGAGGGAGAATATCTCTACTGCTTCGATCAGCACGGCATTCAAGCGAGCTGCTCGTTGCGCATGTCCAGATCAAGCCAACATCGTGAAGTTCC
TGTACACGCAGGAGTGTATCTCGCCTGAACTTATCGGGACCGCGTTTGTGAGTGCGGCCGGATGGGGTCTAGACGATGTGGTGGAGCTGTTGCGCACTGA
TGCTCGTCTTCTTCTGGAGTCCGTACATGAAGCTTTTGTCGCAGCAGTTTGCCGTTGTCAAGTGCAAATGGTGAAGAAACTGTACAGCCAGCAGTCTATT
GCTGCTAGTGTACTGGTAACGGCGCTCGAGAATGTTCACAACTACGGCTATGGCAGGATGGCTAGTACCATTATCGAGTTTTTATCGGCCGACAACGTAC
CTCGCGAGTACAAATTGCAGGCATTCCTGACTGCAAGTAAGCAAGGCAAGCTCGATGTTCTCTCTCTTCTGACTAAGAGTAAAGAGGAAGACTGGCCAAT
CGACAACTTGAAGGCGGCGCTCAGTGCTGCAAGGAACGAGGAAGTCGAGAATTTCATCCGCACGATGATTTGCGAGCAGCTTTTCAGTGGAAGACCTCAA
GAAGTGAGAGCGTCTGGCGGCTGCGGTCACTTGATCTCGACAATGAAATGGGTGACTGAGGAGTGAGTAGCTATTGGTTGTAAGGCTGTGAGCAGCGCTT
CATTTTTTATTGTAACGAGTGCTAGTATTACCGTAAAAGTGAAAGTAAATTGAAGTTACATGGATCACCGCTGGTGATTTCGTGAATATAGTTTAAGTGT
ACCTGTACTCCACTGATTAAGCGAGTAGGTCTATCGCTTCGGAGCGCAGCCACGGGAAATCCCGCACAAATACCTACTAAGATAGTTTAAAGAGTTTACG
TTGAAGTAATAACTCGTAACTAATGACACATTATCGTCGCATCGCCGATCTTCCATGTCACCCTTCAACCTCATTCCTGATTTCGCCGACCCAAGCGCAC
TCCAGCCAGGTCCCGGATGGCCTCGATCCCCATCTTCAAGTACGACCGCTACCAGCGTGCCGCCAGCTTCTTTCTCGACTGGTTGATACGTGCCCATGGC
CACAGCCACCCCACCCCCCAACCCGTCCAGTTGGATACACTGAGTCGAGTCGTCCAAGAGATCGCCAACGATCCGTCCTGCCTCAGCGACAAGCTGCGTC
AAGATCTGCCCAAGGCTCTGGCGGCTTGCAACTGCGCCCTCAAAATCTGCTCGGCGGACGAGTTCCTGCTTCAAACGATAGAAAATCGCGACGTTGGCAC
TCGACTCTCGCGGCTGCTAAAGCTCTGGCACCGCACGCTTGAAAAGGTGCCACACGAGAAAAGTGGGGCGCTGGAGTCTGATGAGGGACAAGAAGAGGGA
GAAGATGATGATGAAGAAGAGGTGGTGAGGAGAACTTTGTTCTCGATGTTAACACGCCAAAACGCGGCTGTGCGAGGAGGCCTTCGCCGACGATTTGCCG
CTGGACGTGGTCTTCTTCGTCTTGGAGCTGGAGGAGCTGGTGAGGGGCGTGTACGAGATCTACACTGCCGTGAAGGCGGTGGGATGCTCGAGGCGACGGT
GGCGATCAAGCTGGCCATGGACACGGCCACTGACCTCACGACGCGGCTTCAACAGCGCCGTCCAGAGATTCGAACGATGGAGAACTTGTTGGATGCAGTT
ATGAAGCACACCCCTGCGATTTACGGTCTAGCGGCCAACTCGGCCAGTAGCATCAAGGCCAAATTCGACAAGGATGGGACTTATATGTCCTCGCCCTTCG
AGCTGGTGCGGGACTTCGAGATCATCTGGGCCGCTTTGACGTCGTTTGCGAAAATTCTCCCGTCAAGCACCAGGGCGGGGTTTCTACTGCCACCGAATGA
GCGAGAAAGATATGGAGAAGAACGCACGCCGCAGTACGTGCTCCCAACTACCGATATTATTGACTTCTTGGTGCAGAGCTTTGCATTGATGTACAACACG
GTCAGCGAGAAGAAGGAGATAACCGGGGGGGGGGGGGGCTTCAAAAGGGCGAGACTGGAGGGCGCGTTCATGTGCTTGATGACCGACTACTTTGCGACGC
GCCAAGTGACCATCCCGCTCGTTTTTGCTTGGACTTGCTGGGTCAAATCTGTCGCTGCATTGCAAGGCGACGGAGGGCTCGGGCGCAACATTAGTGTCAC
GATGAACCACGCAGACGAGTTGATGCAGCGGATGGCTACACTTGTGGACAGACCCACGGTCCTAAATGTCATTAAACCAGACTCTTCGCGTGATGATCTG
CTCCCAAATCGATCGCGCCTCGTCAAGCGCACTAACCCGTTCTCGGCGGGCTTCGTAGTGCTGGACTTCCAGCTCGGCTATCTCCGTGCAGGACATCAAA
GTCTGCTCAGAGCACCGATTTTTCGAGCCTTTGGACATCTGTACAACGCTCTCGTGGGGCAAGAATTTCTCGAGCCTATTCCGTTAATCGAAGACGTTTT
GGAGATATACGAGACGTGGGTTTTCACTCCGTCGAGAGCTGCAGTGGTGCGCGGCGCGTATGATTGCAATTACATCCACCACTCAGGATATGGCGCTACT
TCAGGGAAGAGTGTTGTTTCTCCTGGGCAGGACTGGACAAAAGAGCAGAAGGAGTTTGGAGTGC