Description :
From Genome Similarity Track
Location :
Scaffold_277:637- 4968
Sequence
4331 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTTGATGATGGT
TCCCAAGTTATATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTTAGTGGTATTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCTTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTAC
CAACCGAGTGTTCGGTCGACTGCTGAACTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAGCTCC
AGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGTCCGGTTTGACGCGCTCCATGT
ACAACCACGCCCGGCTCCCAATCTCGAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTCCATCTCTTCTGAAGCTTCTAGAGGGTTTGCCGAGTGTTC
GTTTCCACTTGGTTGAGGTACAGCGGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTTGCTCGTCGCTCCTTTTCTACAGCCTGATAATCTTTG
GCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCTAGTGCGTCAGACTGCTTGCCGAGCCCTTGTTTGAGTGATGACGACATTG
CCCGCAGCGTCGACTGAGCATCCCAACCGTGAACGAGGTAGAACGGCGTCTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACCAGCTTCTC
CGCGATTTCGTCCCAATCTTGCTTCCGCGTACACCCGTACGAATCCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCT
CAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAATGCTTGGAAAACCTCGCTCATGAAGCGTGGTCGCGTCATGCCTATTATGATGGGGCTCGAA
CGTCGTACACACATCTTGGAACACTGGGGCAACATTCAGGGCATTGTTATTGAACATAGCCTGGGACATAAAGAAATTGCGTGAAAGGAACCACGAAAGT
GGGAGCCAACGCGCGTTTGCCCCCCTTAAAAATTTTTCGATAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCAGCTAGCACGTTACC
AGGTGAGTATCCACGAAGCTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCCATTCCAATAA
TAATCGGACTTAACGCGTTGGAACGTTCTCATCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAATTCTGCAAGACCTCTTGAATCATCGTTGTTG
GTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTTTCAGACATACGAACCGGT
CAGCATACTTCCAGCATCTCGAGCTCTGGTAATACAGTTTTTGTGTTTGGGACCCGGAAAACACCTTTTGAGAGTTTAAAAACCATCTTTGTCTCCTTCC
TTCTGTGGCCCGCCGTTATCCTTTTGGGGTTTCTTTCCGCCCGTTATTCCTCTAGGCGGGTTACAACTTTTTTCCCCCTGCGGAAAAAAGCCCGCGGAAA
ACCCCCGCTGGTACAGTCTTGTGAGGATGGTCTGGCAAATCTTTGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGTTCTTGAGCTT
TTGAGACATCCTCCGAGTGTTCATCTGCAAACCTGACTCGTTTCTTAGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGG
TAAGCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACATTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGACGAAACA
TCCACCGAGTCTTCATCCGGCTCGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACTCGACTGACCT
TCGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTT
GTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCC
TCGGCACCGTGCGCAATAGCAGCCTTGACACCGTTGATCATACCTTTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCA
CTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTGTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCC
GCTGTAATTACGGGAAAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTCGGAGGCGCCACCGGCGCGAGCGAGTCTTCC
AGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCACCA
CTGCGAAACTGGAACGCGCGTCCGAAGAGAGACTTCGACTTATGCCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGC
TGGACGTAACAGATCTTCAACAGCAGAAGTAACCGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAAC
CGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGA
AGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATTTTTTGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTT
GAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTT
GGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTAAGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAA
AGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCTAGCAATCGGTCCAGCGTCGCTAGGCAGCTGTCGAAATCCTCGCCACCGAA
GCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACG
AGTTGTAGTACATGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAATCCTCGGCGCTTGGTCCACGACGTTCCTTGGCCT
GTTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCAT
CGGTGCGTTCTTTAACCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACAAACGCCGACACTTTACGCGCTCGCAAGGTCATCATGACC
GCCCAGAAGCCGCTTGCTGCATCCAACGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATTATCG
CGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATAGACTGTCTGA
AAAGACGATCAGTCCCGCACGCAATAAAGCGCGCAGCAGCTAGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCG
TGCCCCTGTGTGTCGATATCGCATACCGCCCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGA
CTAGACGTTCTCGGCGTTCAGTCGACAGCTC