Description :
From Genome Similarity Track
Location :
Scaffold_165:63686- 66928
Transcript NameFunction/comments
Physo_158877hypothetical protein

Sequence
3242 bases(100 bases per row)
TTCACCAGAGGAATACGGCATATTCGAGGATGTGGAAGATCAACGGCGGCGCCAGGTATCGCCACCGGACGTGATTTTCATCCGCCTTGGTTGCGCGTGA
CAAGGCTGCAACCACCCGCCAGAGTTGCTGCATTGCCTCGTCCTTCCAGCTCGTGACCAATTGCGATGATGCCCTTGTCGTAAGCGCAGGAGTTTCTTGC
TGCCGCATTGCCAACGCGTTCGCGTATATAACCAGCCGGCATTTCTCCCGCTCTCCTGATGAGAAGTGTCGATGCAATGCCGGACTCCACACCACTGCCC
AGTCAGGCGACAGCATCTGCCGCACGTCGAGGCGAATCCAAGACGCCACTTGCAATTCCAACCACATTTCATTCGCTGCATCAGCAACGCCAACACAAAT
AGGTCAGCACATCTATCTACCCCAAGCTTTTACGCTCCTGCACAGCAATCCACTTACAGATCGTTGCGCGGGAAGCTCCGCTGCTCAGCAGCAACGCCAC
CAACGTGTTATTCTTGCGGGTGATCGCCAGAGTCAATGCTGATGACCCCGTTCTATCCATCAGCCAAAAAAACAAGTTAGTGTGTTCCTCCGCCATAATG
CATCCATTCGCGGTTGCTTACATCGTGGTGGCGTTGAGGTTGATGTCCTCCGCCGCCAAAAGCCGCCGCACAACGCTCAAACGACTATGAGCCACAGCGT
AGAGCAGCGCCGTCCAGCCTTCCCCAAGCTTCACATTCACGTCACCTCCAGCGTCGCATGAGAGCCACGCATCCACCGCATCCACGTCTCCATTGGCAGC
TGCGTCCAGGAACGCACGCTGCTTGAGGCGGCGATCGGAAGTCGCCATTGACCGAGTGGCCAACATGAAAAATGCAAGTTGTCACTAAGTCGAGGTCTCA
TGTCACTCAAATCCACTTCAACTTGCATGCATCTATTGAGTTGCTTATATTAGCGTGGCCCCTGCGGACGAGTTAACACTTTGGGGCTGCCGGCTCCTTC
CTCTTTGTCGCGCAACTCGTCACCGTCTTCTTCTCCGCTCGAGCCGATCGTGAACTTTGGTGATGGGCCCTTCCTAGCGGCTCGGGATCGAGGTGACAAG
GGGCTTCCAGGTGGAGACGACGGCGACGGACTCCTCGACTCGCTGATTTCCACGATAGTCTGCATGTGCGCACGCGAGGACTCGGCGGGGATGCGCGACC
AAGCGCGCGTACGCCACTTCGTCCAGACCATGACTGCAAGCGCGACGCCTACCAGCGAGATGAGGATAACCTCCGCGATGAAGGCGCCGAATGGGGGACT
TGACCGCTTTGTAGTTCCCTCGGTGGATGAAATGCTCGTGGTTGCATCGGGACTGCCTACGGTGTTGGCCAGCGCCGTCGCCGTCGTGTTTGAGTCCATA
GACGAGCTGTTGCTGGAGCTTGTTACAGAAGTGTTGGAGGGTGCTGGCTGCTCCGTGGCGTTTGAGTCGACTGATACCGGAGTAGCAGGTGCTGGCTGAT
TGGTACTATCTGAAGCGATCGGAGCTGCAGTTGTAGCGTTGGAATAGCTTCTTCCTGCAAAGCACCACAACGTAGCACAACGTCAGGTGTAGTTAATTTA
GACATCTTCACGAGAGAAGGCGTACCGCAATCTGACTCGGCGAAGCCCACACGCTTGTTCTCCACATCAAAGATTACATCAAAGCCGACCATGGCGCTCG
CGCCAAGAACTGCAGCGTTCGAACACGAACCGTTAGAATCCAAAATACAAGACAAACAGTAATGCGTCATACGTACCACCGCCACTACGCTCCGAGAAGT
GGAAATTGCCGTAGTAGGACTTGCCGTCGTCAGCCGGGGTAAGATACTGCGAGGCAGGGACGTCTAACTGAACGTCATCGGTGCCGTCGCCTTTCATTCC
ACTGAGAATGATGGAAATTACTGGGAGGGCTGCCAATTCCTCGCTGGTCAGCTTCATGCGGCTTTCGCTATAGTCTCGGCCTGCTGCCTTGCTGAATGCG
CTCATGAATGCTCGCTTTCCTTTCCCGTCGAAGAAGGTGTCGGTTGTGCCGCTGTCCACAATCACACCCCTGCCTGAATTGATCGTGCCAGTATCGATTC
CAAGCGAGACGCCATTCAGCAAAATATCTTTCACGTGAACTGGATAGTAGGCGGACTTGTCACTGAGCAGCGGCGTATACCCGACATCGCTCGTGTGGTG
GCTGTAGTCCACACCTCCGAACACAAGTTCACCACCGTCCCCGGCAAAGCAAAGGGTGAAAAGGTTTTGCGTCACGCGGCCTGCGTTCAGCATGTATGAC
ATGACAGTGGAGCGATGGCGACCGAGGCCCATGATGCCGTTCTCCTTCTGCGTGATGAACAAACCTGTCTCCTTGGTCTGGCAGCCTACAGGAAACCGAA
ACCCAAACGTCTTCAGCACTCCTTCCATCTCATCAGCTGGCGACGAGAATCCTCCCACCCACACCAGCTCGTCCACCATGACGGCCTCCCACATACTCCC
CTCCATATAGCTCTATCCATCGACGTCAGCAAAGCACACAGTATCAGGACCAATGCCTACGTGACCCTGCAACTCTTGTATCAGTGCCGTACCTGCGAGA
TATAGCAACGGTCCTGCTCGCATGAGCGGCACGAGTCGAAGTCGTGGCAGGCCAGATACTTGGCCGTCGTCGACTTTGATACGTCGAATAGTGGGTCTGT
GTGTTGTCCACAACCCTGGCACGTGCTGCACGGCAGCGCCGTCAAGTGACTTCCCGTATCCACGATCACTGACGCTCTCTGCGCCGGGATTCCCAGGTAG
ATCTCGGCATAGTGAGTCCTATCCAAGCAGCACGGTCAGCTCAATAAATGTAGCCATATCCCTTCAAGCTCGCCAATCTCTTCACGCACCCGTAGCCTAC
ACCAAGCGGAGCTTCACTCAGTGCGAACGCCCCGACTGGGGAATCTCCATCCGCGTTGCCTGCCTCCTGCGCTCGTCGTTGCACTCGCGCCTGCTGGTGT
GCCAATATGTAGGACAGCTCTGCGCTCGGCTGCTGCTGCTTGTGAAGCTGGATTTTCAGCAATCCCTGCTCACTAGCAGTGAGAGAGGTCACTTGGGTGC
ATATTGCAGCCACCAGCACAGCCACAAACGCTCGCCATCGACCGCCAGACGCTCGCGGAGGAGTCATCGCGGGCAGGTTAATCGCCGAGTGATCGCATTG
TTTCGGTGCAGCTATGGCCGGTCTATTTATGGCCAATTAGAA