Description :
From Genome Similarity Track
Location :
Scaffold_37:63685- 91192
Transcript NameFunction/comments
Phyke_g2208hypothetical protein
Phyke_g2209Mitochondrial Carrier (MC) Family
Phyke_g2210hypothetical protein PHYSODRAFT_353502
Phyke_g2211hypothetical protein
Phyke_g2212Mitochondrial/chloroplast ribosomal protein L13
Phyke_g2213conserved hypothetical protein
Phyke_g2214dynein heavy chain

Sequence
27507 bases(100 bases per row)
TATTGCACCATTGTCTGGGCGTTTGCTGGCGCGCGCGACGCATATATCGCTGAGTTTTGCTTGCGAATTGTCTTAATCCTACGCTGCGAAATGAGCATGC
CAAAAGCTGTCATCACCACAGTGAAGATAGTAGCCACAGCCGCCACGGCGATCCAAGCGGTAGGACTCAGACCCACGAAAACCTTGTCACCACCGCCGTC
AACGCTGGTCGCAGCGGCGCCGGCTGATGCACCCGTGGGGATAACAGGGAAAATGTTAAGCCCGCAGTTGACCTTGGCGTCGGCCACCAGTTTAATGAAT
CCACTGGCGCCCCACGAGCTGCCGTAAGAGTTCTTGAGAATCCAATAGTCACCTTCCGTGGCGTCTGTGCCGTAGCcaacaagcagaagcgcgTGATTCA
CATCGTTCTTTGAAGACAGATCACCGTCGTTCGGACAGCTGTAGAATCCTCCAGCGTAGTCGCCGAACGGATCCTCGGAGTTAATCGCAACCGCGATTGG
CTGCTGTTCTAATGCTGTACGCAGCAAGATGGTACAGttgctggaagctgtgcaATCCGAACCCACAACCTGTTCCCAACCGGTAATACTCGCGGCCGTG
TCGTTAGAGCTCACCGAGCACGATGACGAGCCGTTGCCGGACGACGTGCTGCTCGAACTGGAATCATCGTACGGCATAGTAAGCTCAGTCACAAGCCCCC
AAGCATTCTGCGCAGCGTCAATAAAGGCACCATGCGTCATACCACCGTTGCACCCGTCGTTCTGCGACTCCCACTTGATCTCCGTCTCCATCCAAGTTGC
ACCGTCCACACCACTATCTGTAGCCCAGCAGTAATCAAACGTCTGTGTTGTCTCCAAGGTACTACACGTAAGGAACTGCTGCGGCGACAGCGCCACAGCC
GCTGATGCGTTCTCTGCAATACAAACTGCAGTCTCAATAGCATCGGCCGCAGCGAACGCCCAGCAACTGCCACAGTTCTGTTGACTCTTGACTGATGAAC
ATACAGTGTAGCCGAACGAGTTGTCTGTATCACACCAGTTCCAGTACTCGGAACTGCCTGCACTGGACACGGTACTACCAGCGCTACCACTAGCCTCTGC
CACAAGGCGACGAGACTTGGCCGCCTTCACTTCCTGgtccacgagctgctgaggCGTCAGTCTACgccacgtcgacgacgtcaagtgACGTTCGTTAACG
CCCATTTGGTACGAGAATTGGTGGTTCACTGACTTGGCGTACATGTCCACGTCTACATCGAGTGCAATAACATGTTAGTACGAAACTCTACAGCGCATGT
GCGTTGATCACTACATAGCACCCACCTTCGATATATGTCATGTGCGCTTGGAGGTTGCGGCGGTTTCTCTCCATGTCGCCAAAGGATACGAGATtgcgct
ggaggaggagctcccGCAGTGTGTGTGCATCCACGACCTCTCCATTGTGGCCAGCCCAGAGACATGGGGAATCCGTTGATCGGACAGCGGGACAGTCAAC
GAGAGCACCGAGAGACCGTTCAGTCATtatggtggcggtggcggtggatgCGGAGAGCGCAAGGAGAGCTGCTAGAGTCCGCATGGTCTGAGCAGAGGTG
GCAAGGGGCGACGGTATGTTCAAatgcgctgctgaagacTGTCTCCCCAGTCGACGGTACGATTattttgacttgatttcagtaaAGGGCTGAGTCACAC
GGGTCAAAATCCAGGAATTTAAAGCAATCTTTCAGTGATTTCTATACCGATTTTGGTATGAAAGATGCAATGGATAAACCCATGAGTCAGCTGCATGGCC
ATTGCCAAGATTTGGGAACTGAGCGCTGCAATGGCACACTAGCACCGAGAAATTGAAGAGTCTGCAAGGCACATTTTCTCGTGTTGGCGGATAGCCATGG
CAGATAGCGATCGAGTGGAAACAGAATTCTTGTTACCCAAGGCCACTACTTGCAATCTTCCCTGGCTCAGGAATTCCCAGACGTATTTGCCCACTCGTAC
ATGTAACTTTTGAAGATAGCCACAACACAGTGGCCATTGACAACGAGTGATAGTACCAAGTTGACTGGATACGAGTGCTACAGGCTGTTGCGGCTGACTA
GCCTCAGCCAGCTTTGATTGCGATGGAGTCCAGCTGGCTACTGTATGTGTATTGATACTGAAGCTTGTAGCAGGTAAAAATGGCAGTGTTGCGTTGAAAT
GCCGTAGCGGTGATCAAAACCCAGGCGCCTACTGAGTTTCTTGGGTGAGCTTGCTGATGGGTCAGAGTTGTCACCTCCGACGTCGTCATGTAAGAGAAGC
GAATCTCGACTCGAAAGTGATGTGTGGCTCGGAAGCAGATGCGACGTCGAAATTTCGCTGCTTATCCAGCCGTTGATTTGACTTTTGTATGAAGTCATTT
ACTGGACCACCGGCtgcatacaaacatcaagtacTCTGGAATCAAACAAAAACTGTCCACACAGCCGTCTCCATGAGCTGCAGATCACGATGCGTAGTCC
TCTTCGACCTCTTGCTGGGCCATCGCAGTCGTTTCCATTCTTGGATTCGCAGTCCCTCCAGTCCAGCAGATTCACCTGAAACCTCTCCCTGCTACAGTAC
TTATTGAAAGATGGCGACgcaacaggaggaggctCCGCTCCAAGTGAAGGCAGTGATCGAACCCCAGTGGACTCGCTTCATTGCAGGCGGCGCAGCGTCT
GCCACTGCCGAACTGCTGACGCTGCCCATTGACATCACCAAGGTGCGACTTCAGGCGCAACGCTCAGTGCCCTCGACAACTGGCAAGCCCACAGTGCACT
ACAATGGCATGCTGCACGCTGCTCAGACTATGATCAAGCATGAAGGGCCCGGTGCGTTCTGGAATGGAGCAACGCCTGCACTGATGCGCCAAGTCTCGTA
CACGAGTATCTGCATGGTGCTATACGAGCCGCTGCGCAACATTTTCGGAGCCAGTTCGACCCACGGCGCACATGGTGAAGTTCCTTTCATCAACAAGTTC
CTGGCTGGAGGGTGCGCCGGCGCCATCGGTATCAGTATCGCTAACCCGTAAGTTCGCTGCAGATATATTTTTGTCATAAGTTACGCGGTGGGTTAACTGA
TTGATGTGGTTGTGATTTGACAGTGTGGACGTCATCAAGGTACGAATGCAGGCAGACCGCACGGGTAAACTGTACCGTGGAGTAGGCGACGCCTTTACGT
CGATCTTCCAGCGCGAAGGTTTCCGTGGGTTCCTTCGTGGGATGCCGCCCAATATCCAGCGTGGGTTCATCGTAAACGCTGCCGAGTTGGGCACGTACGA
CCACAGCAAGGAAGTAATCATTGCGTCGGGCCTCCTTGGTGATGGCGTGTGGGCACACACGGGCGCCAGTTGTGTGGCAGGATTCgccggtgctgctgct
tctaaCCCGTAAGACCCTGACCGCTTATGCGTCTCACTTTTGGTTGGCTTGTAGATTGTTAACATgaaatgttgctgttgtcctTTGCTGTAGAATTGAC
GTGGTGAAGACGCGTTTGATGAGCCAGCCGACAGACGCAAACGGTAAGGGTCTCCACTACAAGGGTATGATGGACTGCATGCGGAAAACCTTCCACGAGG
GTGGCGCGCTCGCCTTTTACAAGGGCTTTATCCCGAACTGGATGCGGAAGGCGCCCTGGTGTGTTGTCTTTTTCGTGACGTACGAGAAATACCGCGCCGC
GTTCACATCTAGCGACGACGCTCTCTAGAAAATGTTTTCTATAGACTGCCCGCCAGCAAGCGCTGCTGAGTTGGCAGAAGGataacaaaacaaaatctCT
TTGATCCCATCATCATGCTCACTCCAAGAAGATTTTTGCAGGTTCACATCCTTGGTATATTGTTGATCATGTTCAATTTTATGTATGACGTGCAAGCACT
CGCATGCAGCCTGTCACCGCACCTCCCGTCGTCTCGATAAATAGGATTATATTACCCTTCCCATAGTATAGAAGGCAGCGCCTGTAGGCCTGGACCACAG
ACTTCCAGGATTTCTGGAAGCTTCTCGTTcacttcctgttgctgctgtcgaacTTGACGTCGTAAATCTTTCTTTCTCAGCCCCAACAGCCAGTTAATTG
GCTTTCTCTCATACACGGCAGCGAGGCCTTCATCTTTGTGCACTCGTGATCTCAAAATCCACGAGCCTCTTCAGCACTTAAGCTCCTCGAAGTCATGCAT
CTGCATGTACCACGTAGAGTGCGGAGGCGTCAGATAGTGCATTGGTGTCGCTCCATCTGGTAGATTCTGCACCAGTTTCTCACGCAGGTCAATAAACTCG
TCCGTTTGCACGACATTAATCTTCTCGTTATCTGTGGGGATCGACACCTTGCCGCTCTTGGGCAGCATCACGATTGGCAGGCGCTCAATCACCCTGTCCT
CTGTGGCCCATCGGTCCCGCGAGATCACGTGGACATTCAGGTTCGAGAACGATCCGTTCATGAACCGGTTCGAGATGGTGCTCTCCACTGACGGCACCGg
agcttcctcctcctcttcctcttcagagcAGTAGTAGGCTGGACACGTTCGTCGACGGCGTGTGGTCGTCGCGTTCTTCGAGTAGAGCGAGTGTCGGAAG
CGCTCCCTCTCACGCCGTCGgttctccagcatttcctcACGCGACATCCGCTGTTGATTGGCTGTGGAGTCGTCATTAGTAGGCACTGGAGTGTAgttat
tgctgttgctgttcaggaagctgccgttgctgctgctctttgtGCGGTTCAGCGCGTTCAGCAGTTTCTGCAGTGCCACGAAGGTCTCGTCtacctcttc
ttcctccacaacGAGTCCGTTGTTCTCGTGCTCTGGCATTGAGCCTCTGTACGGCATTTTCTTGGATAGTCTGGTGTCACGCCTCTCGACTGTCATGGCT
CTTTCTGTGAGTTATTGAATGGTCACTCGCTGTTCGGATCGATCGATCAACAGTTTGCAGTCTATTTTTTTCTGTTCCTGTAGGTATGTCTTCGAACCTC
AGGTTCATGTAGCAAAAGAGGAACTGATAGTAGCGTTCACTTGCGGAGTCAGTTGATCGCACTCAGTGATGGGTTGTTATCGTTGTTTTCTCTTAGCTCT
TCGCAGGACTTCGCAGCTCTTTGGTGGACAGCGCAAATGAGAATCTGGGACGTAAGCCAGACGTCTGCCGAATTTCCCCACCCCTGTTCTACGTTTCATA
GAAAGGAAAAATAGCATTGATTCACAAAAGAAGGTGGGAAAAAACACCGTTATCTGCTGCATAAGGTTTAGATCGCAACGAGTTTTGGCATGAAATTGGG
TTTTCTATCTgcgatgaagagcagccAGGCATGGCAAGACAAGGCAAGCGATAGTGTTTGCTATCTTTATGTGTGGATTCTTTAGGTGGTTGCTGGCGCA
CAGCGTTTCACAGGTGGCGTGTATGCGAAAGTAGGCAAACATGAGCTCGACCGTCGACGGTGTCATGCGCCTCGGACTAGGGTTGAACGTCAGATCGGCG
CACAAACGGTCCAGAAACTGGAGGCAAATCCGCGCCGCAATCTTGCCTACGCGCTACGCTGCATTTCACCGAGTGCTTTGGTCCACCGCCAACAAGGCCG
TTGTGTGTGCCGCTTCCACTTCATTTTCAGAGATCGTAGCAGAGTGTCCGCAGTCTATGGATATAAGCGCAGAATAGTGCCGTTGGTTGCGGCGCTTATT
TGCTGAAacggcgtcttcatctgtccAGAAGAGAACTCGACGATTTGAACATTTTCCAGGTATGCACACGCGCGTTGACTACCATCGTCACAGCAGGCAC
CATTGTCGCATTCGGCCATGTAGGCAAACGAATTGGATGTGTAGGTGGCAATAAATCTGCAATCAAAAGTTCATCGCAGGCCGCGAGAGGTTGTTGCGAT
TCGCAGCAACCTCTATTTCGAGCAGGATACATACAATTGCCCGTCCCATAATCATCTTTTATCTTGACTTCACTAAAGTCCGATTTTATCAAACGATTTa
gtgtggtccacatatTCGAGTATCCGTCACTTCAACCACCACGAAAGGGCGTGAAAacggagctcttcgacagATCCGATCGACGCCCAAGTCGCCCTCG
CGATGGCggacctgctgctgcgctggatcaaccatgaactgcagctaTCCAAGCACGTGACAGACGTGCAAGTGGACTTCGCCAGCGGGTACCTACTAGG
TGAGCTCCTGCACCGCCTtaaccagcagcacaactTCGACGACTTCGTGCGGAGCTCCACAGCTGATGCCAAGATCATCAACTTCTGTCTATTGGAACCA
AGTCTGCGCAATCTCAATATCCAATTTGATGCCAATGtggccaccgccatcatGAACGAGAAAAAGGATACGGCTGCCAATCTGCTCAACCAGATCAAGG
TACGGCAATCACATCAGACGTCGTTTGCTGGGCCTTACTTGAGAATTGATGTTATATTACGTGCAATTGATATTTGATAGATTGCAGCCACTAGATTGGG
GAGGGCACCTAGTGTTTCGACGAGGTCACTGGAGAGAAAATCGATCTTTCCACTACACAATCGACCAGTGAAGCTGGCCAAACCGATTTATGACTCTGAG
AATCATCGCTTGTTCGAACATTCTATCCGACGACATGTACAGTCTGTTTCTGCAATTGAGCAGGACAAGTAAGTCGTTTTGTTTCCATGATTTTTTGTAT
AGGGAAATAATTTTTGTTCCCGCTGTTTGTATTGTTACTAAAGGGGTCGTGTCGTGGAAGAAAAGGACAAACGACAAGCTTATCTTGACAAGGTGGCAAG
TCAAAAACAGTTGCTAGAGGCCACGAAAGCAGAAAGACTGCATCGCGCTTTCATatacagcagcttcattaAGGAGGCACTTGATGAAACGGACTCACCT
GCTTGGAGgcttgcactgcagaagaagaatgcGCGCGAACAGCGACGGGCTGCATTTTTTCAGCAGTTAATGAagaaacgagaagaagcggaggTTGATT
TTGTACTTATGTAGCAGCTGCTATCTATGAGTTGCTGACGCATTGCTTGTCTTGCGGTTCTGATTTGACAGGAACATCTATCTTTCAGTCTTCGtcagca
agtgcagcgcGATTTAGATGATTTCGACGTATGCGAGCGAGAAACTGTGTTGGATTTTATCCCTTGACGATTGAACTTACGTGTTGTTTCGTACTGCCTT
GTTTCAGTCACGTAGCGGATCGGTACCCGGCATTGCGGGAGGCAAATTTCCTTTTCGCAAGTCTGTAGGGTATGGCCTCCGCTCactcaccaccactttg
GGTTCAGCTTCCGACAAAACGAAATACTCGACTTCAAACTTAGCTGGGTCAGCATCGAATGAATGGGAATTACATCAAGCAAATATGATGGAAATGGAGA
GTACGATGGGTaccatcaagcagcaaaggAATCAACGCGAAATGCGCAAGGGAAATTTATCTCGCAGAAGAAAGCGGTTCATCCAAGAATGTGTTTACTC
CCACTCTCGAATAGAGACCGCGCGTGTGGCAAGTATTCTGGAGGATGTGGTGCTGCGAGATACAAACAGTGAAAAGGATATACAAGGTGAAATGAGTCGT
ATTCTCACTTACAAAGAGGTAGCTCGAGAAAACCGGTCCATGCGGGATCAAGAGTACGTGAATCAACAGGAATTGGACACATTGACAGCAGTTAACAGGG
ACACAAGCTGCTATCACAACCTCATTCTCCGatttgaagatgacaacgAGATACAGACAATACAGCGAAGGAATGTGCAAGTTTCTGTTGAATCTGCCGA
CCATCACCTCAGCAAACAAATTTCGGGGGTAATCATGAATGACCTGGTGGAGTTCGTGTTGTTTATTGCGGGGAAGAGGGAGGATACTATGCATTCTAGG
GATCCAACAGTCTTCTTGGCTTCCCAAACGTGGAGTGAGTACAAGATTCAGTTTGCAAGCAGTCACATGATCAGTAGCATGTCATCGTTACCAATCTCTA
CAGACCCCAGTTTTGGCGAGTTTCTTAACAGCCACGTATTGGAGCAGTATTTGGCAAGTTTTCCGCTATCTCACACAATACCTGTCAGTCAACCAGCTTC
GAGAATTGTCTCCGAGGGTGTTCTTTTCCTCGGAACAATGGATGTTATCAAGGATTGTTACGTGCTTGGGGAAGAAATTAAGGCATTACGATGGATCGCT
CGCGCTAGTGGCACCGTCCAGCAAGAGAGCGTGGGTGGTTTACAGATGCCGGCCTCCAGTCAGCCTGCTGCCGGTCCACGTCGACATCTCCGCATCCTTA
TCTTTGGTCCTCCGTTTGTGGGTAAGAAAACTCAAGCAAAGCTTCTAGGTGAAAAGCACAACTTAGTTGTACGCTCAGTTCATGAGCTGATCCAGGATGC
TATCCTAAAATCAAGCGACGTCGGCAGGCAAATGGAAGCTCTTCTTTCCAATGGAACTGAACTTCCTCCTGAGTTTTACAGTCGACTTGTGGTTGACTCT
ATCGACGATATTGAAGCCCAATCACTCAGACCagaaaacagcaacatggcTGGCTGGATAATTTATGATTTGCCTGCAACAGAACAACACAACCAGAATC
TGGAAGAGAAGCTCACGGGGTATGTGGATCCGACACTAATCCCTTCCTCGTATGATTTTGAATCTCCCATTGCCCCCGGTTACAGTAAACCTGCTTTGCC
TCCAACATTCCTCCATGGCAAGTCTGGCGTGGATCTTGTGTTTCATCTTGATTGCCCGATGAACACAGTCTTAGATCGATGCTTGGGTAGTGTTGAGGAC
AGTTCGACAAGAGAAACACATCATTTGGTGTTTAACCCGCCACCAGACGATTCGACTGCGCGCCATCGTTTGCATCATGTGAATCCAAGTGCTGGCATCA
GTGAGCTGCTATCATTGCATTGCCTGGCAAACGACAATTTTTCGCGTGATCATAAAGCTTGGCATGCGAAATTCCGGACCTTGTACGAGCAACCAAGTTC
CGAATTGACCATTAGCGAGGTTCAAGAGGCTATGGATACAATTGTAAGTGCTTTTCAAAAGGAGGTGCAGAATGAGGCTGCGTCGAAGCAGTACcaacag
gaagaaaatgAGCAAAGGCTTATGACAAGTGAGCAAGAGAGGCACCGACatatttttgcttttgaagcagcaattgaTGAGGCAAAGCTGGATGTGACGA
AGATTGAGGAATCTATAGCggaagcagaagaagcaaaagcaaagaAAGAAGAGATGCTAGAACTTCGACATACTCTGGAAGAGGCCCACCGTCGGCTCGA
AGGGGTCGTTGATAGCGCTAAAAGTtggcaggaagaagaactgtCGCTCCGACCAACAACAGCCAGCAAATATTCTGGTGATCTGGTACCATCAACCGCC
GGTGCACTGGTGGCTATATGGGACGACATGGAAGCAGAGTACATCACTAGCATGAAGACCAGCTTTGAACTGCTTCGAAAGCAGCGGCACCAAGTTACCG
ATCATGCGCAAATCGTGACACGTGACTTTTGTGAATTTGTACGGCGCCCTGACCAGAAGCAAAATATTGTCGACCAATTCCAGAGGAGATTCAACGAGGT
AATCGAGGAGATGCGCTTTGACGACCTCACAAAAGTTGAGCTTCATGCCCGTGTGGATATCCTACAAGATGAATTGACGGATCTCGTGGCGGCAAAAGTG
TCagagaatgaagaagaactcaGTGGCATGATTGGTGACGGGTGGATGGAAGATACGTGTCAACAAGTCGCTGCCATTTATCAAATCGCACTTCAAGCGG
AGTGTGATCGCTTCCGCGTGTCTatccagcttcttgtagaTGGTTACTACTCTGCAAGCACTGATCACTCCCAGTTGAGTAGTGTAATGGAAAGTTGGCA
GGCACATCAACCTCGACTAGATTTAGTTTGCAAGATTTATCGAGATCCAACAAATGAAATCCCTCAAGAAACTCcgcctgctccagcagcgactggtAAA
GCCGCCCCGAAAGGAAAAGCAAAGCCGTCCACACCAGCTGTAGTTCCCCCGGCTTCGGTTGCTACAAACGAGGAAACCCTAGCGGAATTGCTGACGATAA
ACGAGTTGTTAGCAGAGTACAGTCGGGTTCTTCAGCGTTGCGATTCTTTAGTAGAGGCGAttgctccaattgctgctgctgctggtgggAATGGTGCAGG
AGGGAGCGAATTTCAACAGACTGAGGATAGCCTCTCAACCGATAGCATCGGTGACCTCTGCAAGATGAACTTGCTGAATGGGATCAGGTATGAGCACAAC
CTTATGCAGAGGCGAGTGCGATTCCTCCAAGTAGCTGCCGAGAAATCCTGCGATGAAATCACGCGATCCATGCGCTCCATTGAACTCACATTACGGGATG
TTCTAGAGGATCGAAAAAATCGAGAGCAGGTGGCAGTAGCTGCATTGGTCGAGTACGTCCATTcagctgtcgaagctgaagtaGCTCTTCCGTCCTACAT
TGATGTCAGCGTAAGTACTTTGTCACCTTCTTGCTTCCATTCTACTTTGCCAAGCGCTCTAATGATGTTGTGCGCATGTTGTACCGCAGCCTGAATCCAC
GGAGcgttttccagcaactgTTCAGTTGCGTGAAGACACCTTGGTCCGAGTCAACACTGGTAGACGGTTGTTACCACGAACTCCACCCGATGCACCGCCC
ATTATTGAAGAATCGCATCCATTACTACTTagcgagcagcaacgcgacGACCTTCGTGATGTATTACTGTCTCAGAGCACCGACAACTCTGGGCTGCTTC
CGCTGTGTCTTTTGATTGAGACGATAGCAGCATTTACTTCTCAGCCCGACGCACTTCCAGATGTCTGGCGCCGATGCCCAGCGCATATCATCGCAGAGGT
AAGAGAGGAGAGCATACTAGTACACGTACACCGAAACTGACTTTGAATGCTTTTAACTGCGAAAAACGACAGATCGCTGCAAGTTTCACTACGAAGCAGG
GAGCCTTTGTTGACGTTGAGGCTTTGCTTGATGCGATGAGCACTCGCGaagatcttcttcagcgattCCAAGAAGAGGCAAAAGAGCAGCTCGAGCGCCA
GCGACAATTAGAACGGCAATGTCAGCAAGAGGAACTCGAACGtgaactgcaacagcaggaacaaCAAGAAACCCACGAAGCCGAACCCACAAACGTACAA
TAGTAGAATGACAACCAACAATACTAGGGAGCAGCCAACGACAAGGCCACAGCAGTCGTGTATTAAGCCACCGGTATCCACATCCTGCATCTTAACGCGT
CCATCACATACTGCATCGTAGCCACATCAGCACCTGGTACGTACCGACCCCcatcagttgctgcaccaactgTCGCTTCCTCTATATCGCTGTTTCAGTG
TCTTGGACACCTGCTTACAGGATGACGGGGTTCTCCCCGACCTCCGCCGTAAAGTCGTGCTCGTCTCCCAGGAagatcttgagcttcttgtcctgcagAG
CGCGCATACGGTTCTTGGGCAGCATGCCGAACACTGCCTTGCGCAGAACCTCCTCCGGCTTGCGCTCGAAGAGATCCTTGGCCGTGCGCTGCTTGAGTCC
GCCCGGGTGTCCCGTGTGCCAGCGATATAACTTATTGTTCCACTTGTTGCCTGTGAGCTCGATGTCCTTGGCgttgatcaccaccacgtagTCGCCGCAG
TCCACGTTTGGGGCGTACGTAGGTTTGTGCTTGCCGCGGAGGATGGGGGCGAGCTGCGACGCCAAACGGCCCAGCACCTGGCCCTTCGCGTCTACAACAT
GCCACACCACCTTGGACGCCTGTGCGACCTTGCTCATGATTCCCAGGGACGTTCCGAAGGCACGAACTCAATGCGTTGCGCGCTCTTGACCGCAGATCGA
AATGCCTACAGAACCACCACCTTAATGCCACACCAAACGTACATCATTTCTAAAATTGTATAGTGAAGGCTATACAAAGTACGATTGGGAGTATACGTCC
GAAAGTATACAGGGTCTCAAAAATCTGAGCGAAGTGCTCAGATTTGGCATTGGCCGGCCATTCGAGATCAACCATGGGGCGCTACACGACGATGCAGACA
TTCAGCGACCAGGACGCCCAGGGTGCTGCGGTCTCTTACGACGGGGCTGCAACACCATCATCCCCTTCTACAGCTCCCACTGCTTCCTCTGCTCCCAATA
AACCCAACAAGGACGACGAATCCAAGGCGCAGATCAACCGAGTGGACAATGTCTCTGGTAGCTCCGCTGGAGCCGGGAGCGGAGACTTCCACACGTATCG
CGCGGCTCGGAGACGGTAAGAAATTGTCGTTAACTATACCAATGTTAACATATAAACTAATTGTTTATTGTGTCACTAATGACAGAGAGATGGAACGTGT
GGCCAAGATGGAACAGCGGTACTTGGAGAATAAAGCCCAGCAGGAGTTTGAGACAAAGCGGAAGCGCAATGCGGAAGAGTTTGAGGCCAAAATGAACAAA
AAGGCGGACAAGAGAAAACGACGCAAGGAACGAGCGAAGGCGAGATCTATGGGTGACGatcaggaggaggaggaagagcagaaagAGACCGAGATAAAAG
AGTCTAAAACAGACAAAAATGAATCCGTGCCAGAGACTCCAGGCGGAGTACCAGAGATCCCTAATGATGGAAGCTTCTTAGAGAGGATGTTGGCAAtgca
gaaggccaaggaggagGCTTGACGGGTAGATAAATAGATCGAGACCAGCCGTACGAGTTGCTGTATCGAAGTCTGTTCCAATAGATATTCATTTGCCAGA
CTTCTTTCTGCATTTCCTACTTGGTTGTGAGCTGTCAACGTTGGTGCGCATACATCTACAAGCAGTCAAGGGAGTGTAATGTTCTTTGAACCGAGGTTAG
TTGTCATCCTGGAAGATCAGAGCGACGCCGCGCAAAACCCATTTGGCGCTACCACAATCTGTTGGGAGTGTCGCCAACAGAATGTACGTGTGGCCTCGGA
AGCGTGTCAGATACACTGGACACTCGTAGATACTTGGATCGTGACGCAGGTAGCCCACGGAAGAGGGCTCCCATGTTGGAGAGGTGGTCACAGCCTTGAC
GTAGATGACCGGCATACTCCAGAGTAGTTCCTTCGGATTGCTGTCCAGCAGTGTACCACCGCACTCGGTAGGTGGACTTGCACCAACCGGGTAGCGTTCG
TTAATCTCGTCCAACGTGCTCCACCGTGCACCCTCAAGGATAAGACCATGCACGAACACGCCATCGTCTGGGTAGTTCGAGATGGTCGACGGGTCTTGAA
TCGTGGTCACGTGCGTCTCCACAGTCATTTGATTTAGCGGCATAAATCGCTTACGAGATGTGACCTGCAGACACGCTGTCGTGTAGGCTGTGGGGTTGAA
GAGGCCCGGCAGCCAAATCGAGAACGGTGTGACGAAGCAGTTGCCGCCGCCTCCCGTCGTATCACCCGCCCACATGACAAGCTGCTCATGGCGCTTCACC
ATGTCAGCAAACCAGCCGCTCAGCGACTTGGTAGACGGCCAAGCCTTCTTCTCCCATTTACATTGAGAAAATGGGTTGCGCCCGGGCACTTCGTTCAGCG
TCATGGCTGTGGCCAAGTCCTCCATTGCTTGCGACATATTGAGCTGTCCATTGAGACCCTTCTTCAAATCGCCTAGCGACAACCGAATTTCCTGGAGTAG
GACGTTCATACGGCTGCACTCCTGTAGCGCCACCACTACGAAGGGGCCATGATCCTCTGTCAGGTGCGGTGTCGCGGCCTCCACAACGTCAAGCATGTTG
AAGAATTCAGGACAGCGTGTTTCGAGATCCTCGATAATGGCACGCAGCACTGTCGTCTTGTCGACACCACCTCCTTCctctccaccgccaccaccaccgc
cggCACCACCGCCGATGGTAACCATTGTGTAGCACAGTGTCTCGCATGTTGTGGTGAGATAGCCGATTTCAGCATTCGGGTGGAGCCCAAAGAGCGGAGG
GGCCTCAGGAACCATGTTCTTTTCGATGTAGTTGGCATAGTCCGCGAATGAGAATTCATTTGGATTGGGTGACTTGAAACCTGGGCCGAGCTCCATGCCA
TTCAATAACCCCGGATCGATTAAGACTGTCAGGTACGTGTTGTTTGTCCGGCGATCCCAAGCGTCTGTAATATGCCCTCCGTACATGATTTCGCCGAACA
GGTAGCGCAGATCGTCCCAAGGGACCGAAGGATTGTTGTCCAAGTACGAGTGCAGAATATTGGCACAGATGGTGAGATCTCCAGTGTTGAAGCTGTACGC
ACGACTCCAGCCTTGCTGCCCAAATCGCCGACGACCAAGCACGATTGCGTGGAACCAGCATAGAGAGAAAAGGCAGGCCTTAAACTCCGCCGGCTTCGTG
CAGGCCTGCACCTTATCTTCGCCAAAGTTTGCCCACGCACGCCGCAAGTTTGACTGGATGTCTGACGGCGCCTCATTTGCCACCTTGATGCAGCTTTGAA
GAAGCGACTCAGGAATATTTAACATATCAGGCAGTGGGGGTGGTTCAGCCGAGATAAAGCACCGGAAGAGATCGTGTGCGCCCTCTGTGGCCACCTCTTC
TAACTGGCGCTCCAGGGTTGGCAACCACGACTGCATCAAATGAACGTTCTGCAATATAATCCATCCACCCTCTGTGCTCAGTCGCTTCAGCGCTTCACCT
GCATATGCCTCTTGCCCCTGCCCCATGGAAATGTTTATGAAGTTGTTATTTTCAAGACTCACGCCGTTGGCTTTTCCGAGAGTTTCGACCCACGGCGTGG
GGTCTACTCCTGGGAACAAAACGAAGAAAATTGGGATACTCGAGTTCGTTTCTGCGTACGTGGATTCCATGTTGAATGGCGGTTGGGTCACATACTCCTC
ACCCAACGATTCTAGAATGAACGTACGCAATGCATTGGTTACGCGGTCGGGTCGCATAGCGCGCAGTAATATTAGTCGCTGGAAAGTTGTGAGCTTCACA
AAATCTCCAGGTACCTTCTGTCGCTCGGCATCCTCGGTAGCAAACCACTTGCGCCATTCATCCGGGTCATTTTGAATCGCATCTCCCAATCCTTGAAAGA
CCTTGGCACTCTCTAAGGCTTTCAACTTGGCCCAAATTGCTGCGGGGAGCCATTCCGAGGCTGATCCCGCATTGCCTGCATCTGGATGCGCCTTACTGAT
AAGGAAGTATTCGACCTCAGAGTCGTGCAACAAACCGTCCTTCAGCAAGATTTTCAGGCATAGCATAGTGGCCACGGTAAGTTTGTTACGCTCGAAAAGA
CCGCGGCGTACGTAATTGTACACGCATGATGTGATGCTATCCATTAGCACCTGACAGCGTGAATGcatttcttcatctgtcaGATCTGGGACGGCAGGTT
CTTCTCTCtcattctcttcatcgccacttccttcaccaccttcaacATTTTCTCCTGGTGTCACAACTATTGCAGCATTGCCAGTAGCAGCCCCTTCACC
CTCTCTAGCAGCAGATCCTTCAGCTTCGTTGGCATTGGCAGTTATAAGTGCAGGTGCCCGATAAATACCAGATAAGAAGACCTGTTGGAAGGACGCGAGC
GAATAGATATAATACGAGTGCACTTTGCTGATATCGCTCATCAGGAAGAAGAGTAGTGAGCCTCGGGCTGCAATGCTGCGGTACTTTTCACTTGTGATGT
TCACTGACTCCTGTGTCTTTTTAGCAGCCTCCATGTTATTCTGTGTGCGCTGTGCCTTGTGCTTCGTATCACTTAGAATCTGAATAAGCGGTTGGTTGTT
CGTGATATCATCGTCGGCACTAGCCAAGTAGAAAAGGATATCATCCTCCAGCTTTTTAAGCTCAATCTTGCCGTTGTTTTGTTCCTGGATAAGTTTTTCA
CGCTTGATAGCCAGGTCCTGACGTTCCTTAGACACGACAAGGTTCAGCAACTGGTCTTCCAGTCCAAGCATAGTGACCGTAAAGTTCACGATAGTGCATT
CGGCTTGAATCTCTGGCGGATAGTGTGGGTTGCCCAGCTTCGTGTGAAGATACAAGTGGAAATTGTCGTTGTACGGTACCGAAGCATCACCGATTTGGAT
TTCGTATCGTGCACCGCGGCGCGAGGTTGAACGCTGAATCACTGGTGCCAAGATCGGATCAATCTTCTCGCTCAGGTTCTCAATGAGGAAGGCGCCGTCT
GTGCCAATTGCTGTTTTGAGACGTTCAATCCACATTTTCTGACCAACTCGAACGATGATAAGGTTGTTGTGCGCCTCCATTTCGCGAATCCATGCAATAG
CCTGCAGTTGTGGATCAACAATAAGTGGTCGCCGACCCATCGACACTGTGGTCACGACAATGGCGCCATTTTCAGAAGACACACGATCGGACGGGAGCTT
CTGGGTATTCCATTGTGCGATCTGTGCGTCGTTCGTTAAGATGAGAAGCGGATTAGCTTCTTCAGACATGGCAATACTTTCACCTCCGGCAGCAGTGCGC
AGATATGGTACCCAGTGTTTATTGATAAGCTCGTCACGGAACGGCTTCGTAAATGGCCCAATGTAGGAGATGAAGGCAGATGCCAACAGTACATCACCAA
CCAAAAGGTCTTTCTCCTTCTGTAGCTGTAGGACGTTAATGCCCCATCGCACGTTTTCACTTGATAGATCGTTGGTAAGTGTCCCAGCAAGCTTCATCTT
GCGGTTTCCTGTTTCAACAGCATTCACAGCGtcttctttctccttctctgctgctgctgcctccgccagcaacttgtcCAGCTTGGCCTGAAGGTCCGCC
ACCAGTGCTGTCACCTCCGCAAGACGAGCATTTGCAGCCTCGAGCTCGGTGTTTGCAGCGGCAAGGGCTTGGCGTTTGGGCTCGACAGTAATGACGATAT
CGTAGTACATCACGATATTGATGACCCAGGAACATAAACCTGCGGCGGCCTTGTTCTTTGTTAAGATTGTGTCGTAATTGAAGTGTTCCATCTCTAAAAA
CACGCGAACCTCCTTCCAGTTCATAGGAGGAACCTTTCCATCGTCAACCACTTGCTTGAATCCCACTAGGTAGTCGATGTACTCGGGAAtgttgccaaga
agctgtttcttggctgTGTCCCATTTGACATCCTTCACTTTGCCAGTCTTTGTAACCTGGACATTCGGATGCACACCGGCAAGTAACACCATTGTCGCTG
AAAAGACATCGTCCACACCTGCAGGGGGCTTCGACATCGTTTTACACTCACCCAAATCTTTTTTGTTCAAAGAATCGAGTGCTGCCATAGCCTGAGCCAC
AGCCGGCTCAGCCTTGGCCAGATCCTCCTGAGTCGATCGCTGTTTCTCCGTAACCTCGGTTTGAATAATGGCACACTTAGCAGCCTCGTCGCCAGCCTTC
TTGCTTTCTGTCTCCACATTTGCCTTCTCTTTGTTGACCGCTTCGGCAATTCCAGACGCTACAGCTTTTTTGTCCTCAGCAGCCTCGAGGATGACCTTCA
GCTCCACTTCGAGTCGAGACACTGTATCTCCCGTCTCTTTCAGCTTTTGCAATCCCTTTTCGAGACGGtcaatggctgcagcatATTCCTCTACTTTCTT
GCGCAAAATCTTCTTGTACAATTGAAGCAACTCCAAGTATGATTTGGGCGTGGTGTACACATGCCGGCGTTCCACCTGGAAGAATCTCTCTGCGCAGATA
TTAACCGACTGAAACGAGAAGGGCATAAATTTCTCGATGCCTTCACGTGACTCTTCTGAGCCAAGCAAATCTCCAATTTCCTTTAGCTTTTCTCGACCAA
CAGAAAGTAGAGCTTCCTTCGGCCACGGTTGGAACCAGTCGATGACTGTGCAGTTTACTAATGCTGGGAACTTGCGTGCACGATTACGGAAATCATCACC
AACTGGCGAGAAACATAGGCACAAGTGCAGCCGCTTTCGAATCTCAGCTTGGAAGAACTTAATCACCTCTTTTCGATCCTTTGTGCCAGCCACAGGCGAC
AGCAGATTGACGATATTGTCCATATCCTCCATTGCAAACAAATCTGGAATCTCACCAGACGCCAGCAAATCGTTTAGGTAGATAAGAAATTTTTCGTTGG
TAATTTGTGAGTCTGTAAGCATGAAGACaacacctccgtcttcttcgttgcgCGACAGCATTTCGACCACTACCATGTGCATCTTGCGCAAGTCTTCCTT
AAATTCATTTTCGCCATACTTGGAGCTGATTGTAATCTGGCGGACAGTGTACCCGCAAATGTGTGAAGCCAAACGTGCCAGCGAACGCTTACCGCTACCT
CCCACACCAACCAACAGTGCATGGCCGCTTTCGTTGCGGAGAATACGCACAATGCGAGCCACATGTTTCACAGCGTCATCGAAGAGATCCAACTGCATAG
CAGTGTTGTTCTCGTTATTGTTGTACTCACGTAGCTGAATCTGTAAATTCGCCTTGAGATCGTCCAGGTTTGTGCCCATGATTTGATCGTACTCACTATC
GCCATCTTTTGTGAAATGACAGAAAATGAGCGGCCACGAATTCTCGGCTGCATAGTATCGACTAGTGTTACATGATGCAAAAGACTTCTTTACTTGCATT
TGCACGAGTTGATTGTACTTCTCGATGTCGGCCTTGCACACAAGTCGGTCACCATATACGCGCTCACTCTCGTGAAGCCACAGCAGAATAAACTTCTCCG
AGCTATTGAAACGATCCTTCTTAGAGGCGATGAGTCCTTGAAAAACATTGGACAAGTGGCGGACATTGAACTCGTAGTGAAAATTAGCTGCAGTCTTGCG
GAACGTGCTGGCAACGCTTGCATGCAAGCTTAGCGCTGCCTTGATAAGCGCATTAGAGAACTGAGAGTTGCTCAACTCATCCGCGAACCCCGAGAGGTGT
CCTCCAAGGAACGTCTCGTAGATCGTGACGAGACTCGGCGCTTCGGGCATTCCCATCGCAAACGTACAGAAGTGGCGCTGCAATCGCGGGTCAACTAAAA
ACGACCCTGCTGTAGGGTTCATGCCGGCAACAACTTGCGTGTTCAGAATATTCTGTGTCTGCAATTTCACACGGTCGAACCAATGCTTGTACTCCATCAC
CTGCCGCAGCAGCGATATAGCGCTTTGTGTATTGTACGGATCTACCTCTGGAAGATTCAGATCGTCCATGAAATAAATGAGTCGAGCCTTGCCTGGTGGA
CCAAGATTGATACCAGTTTTCCGCTCCAACTGCCCGAACATcgtctgctgaagaatggCACTTGTAGTGTAAaaattgaagttgatggtGCAGTATCGGA
ATGCAGCCGTAGCTTCATCTTTactgagcttcttcagcataCCCATAATGTTCTGCGTCTTACCCGTACCCGCAGGCCCGCAAACCATGATCGGAATGCT
TTTTGAAATAAGATTTTCGAGCCAAAACGCAATTGATGCCGTCTCGGTGGTGGGCACCGTGATTTGATTGATCGGACTGGGAGATTTGTATGTCTCTGTG
TAGAAGTACGGACTCTTGGACCACGAATTAAACTTAGACGTCTCTGGGTCCAGCCAAAAATCAAACACCGTGTTGCTCGCTGAGGCTACCAGCTTGACAT
CCTTCCACTGGTTCTTCCACCAATTACTAAACTCGGCGGAGTAGTCTGTGCCATCATCACTCAGGGTCAGGATAGAGCCAAAGGCCCAAACACAACAGAA
TACGAACGTATTTTGCATCACTGTAAAGTCTTCCAGGACTTGAGGGGTCAACAGACAATCGATCATGTTCAGCAAGTTCGTCACTAGCGTCGTCTCCTCT
ACGGGGACGACAGGAACAACTTTCTTACGGAAAAACCGGAGCGTCGTATCGATATACTGATCGAAAAGCCCTTGGAATTTAGCGCGTGTGTCTGGGGTAA
ACATCATGTTTCGCAGCCGGTGGTCAACAGGCTGCTGGCAATGACGATCGATCCAGCTGTCTATCAAGCAACGCCATTGATAACCCTCCGACGTTGATAT
GTACAGGATACCAGCACGTGATACTGTTGCAGGAGTAGCGTAGACAAGATCACGAATCTCAAAAATCATGCGCATGTGAACCTTCAGTGGAATACGCTCG
TTAGATGCCAATGTGAGCATCCGGTTGTCGTCCATCACAGAGTTCATGGACTCGATCCAGTTGGCATCAAGATCGCCATCCAGGATTATCCACTTTGGAT
tgttgtcttcgtcgccaTTATCACGACGTCGAGAGCCTAGATCACGCATAATTCGTGACAGCAATCCGTCCTTCCACTCGCGAGTCTTCAGTACAATATA
CCCGTACAGTTCGTTTGTGCTTACCGATTTCGGATTCAAATCTTGCACTTCCATGGGAGTGCCCATGATCTCACGTGCCTTCCTTAGCGTCTTCCACGTT
TCTGTCTTACCGGATGCAGGAGGTCCCATCACGAATACACAATGCCGAATGGCTAGTAGTTCAGATAGCTGCACGACCTTGAGCATGAACTCTGGTCGAG
GCGTGTTGCCGATAGCCTCGGATGCTCCCTGCACCATGGATTCGAGCTCCATATCACGCTTTCGCGGCGGATCGTTACGCACATCTACATTCGGGCTGTC
GCGTGGGAATAGATCTCCAAGCAAACCAAAGAAAATGACCATGTCCTCCGCGACAATTTTCGGGATGTTAAAGTCTCGCAATGCACGCATGAGCAGATCC
GTTTCAGGGATATCCGGCTCGGCACGTTTGAAAGCACCAGCTACACACAGCACGCTTTTCACAGCTCGAAGTCCCCAATCATAGTGCATTTGTTTGGACA
ACAGTTGGCCAAGCAAAGAATATAATCCGTAAAACTTGGATGCCAAGATCTTGGCCTGTGTGAACCCTTCTGCCATAAGCATATTCTCGCAAATGAGCAC
CAGATCAGGCACCATAACAGTCATTGGGCGGAATAGCGCCTTCAGACCTTCAGGAAGCTCAGATCGACCCAAGTAGCCGGGATTCATAGTGATAAATGCA
CCAACAGTCGGGTCCAACGCCACATCGTCATTCTCAAGAATGAACTTCTCGTCATCTGCTTTACATGCGTCGCACACAGCTTTAAACTGGACTGAGCACA
CTGACAACACTTCTGGTACCAGACGATTAAACTCGTCAAAGCACCCCCAAGACCCAGACGAAGCCAGGCCTTTGAAAATATTCCCGAGACTCTTGTAGTC
CATTTCAGGCGAGCAGTTGAACACGTAGCATACCTTTCCGAGCGCGTTGGCCAAATCCTTAGTTGTCTCCGTCTTACCCGTACCGGCTGGACCAGCAGGA
GCACAGCCCATCATTAAGTTCAATGCTTGCGTTGCAGTCACGTAGATTCGATCTGTCAGCGGAGTAATGACGAGTCGAGGTCCGTTGCCTAAATACTCGT
AGTCATATGGAATACCAGCGTCACAGATTAGGATCTGAGCTCTTGCATTGTTTGCGCCACGAAAATTCATATCGCGCTTTTGAAAGCTTCCTGCAACTGG
TGAGAAGTAGTGTTTTAATTGTGACTGCCACATAAAGTGAGATGCCTCCTCCACTCCTGCACGAATCATATTTGCCACAATATCACGTCCGTGAGCATCC
ATGGTAATCAATACCATCACACGTTGACGTTCCGCATACGAAATATTGCTCTGCGTGAGCTTGATTAGATCTTCAAgctgtttttcttgcatCTTGTTGT
AATTTTTAAGGGTATCCTTTTCGCCATTCTGAATAGAGCGGAAAGAACGTTCAACTTCTTGGACATAGTGCACGCCAGCTGCGAGCAGAATAATTTGTGC
TGCATCCATAGGTTTGTTGGTATCATCTTTGAAGTTAATCCAGTCAACACGAGGCATCTCAGTGTATGCTACAAGCGACCGCTCGATGTGCTTGAACAGC
GTTAGTCTCATAGCACGCATGATCGTCTCGAGGTAAATTTCTGCCTCTCCATTCAAAACAGGGGGCTCAAAGAAGTCGACAACTTCGTGGCCCACACCAG
CTACAAACGAGGTAGCGACTGGCCGCTCTCCGCCAGCACGATCAACCAGAGTGAGTGTCTTGGTTGCGAGATAGATCTTGGAGCAATGCGGCATGATCCG
ATCGGGGTGCGATCCGTTCGACAGGATGTCCAGCAAGTCTGCCTCCGACATGAAGTAGAAGCGAGGAAACTGCCGGCGACGTCCGTCCAGAAATTCTTTT
AGGCGGTGCTTGCACAGCTCAAGCTTCTCGACAATACTCTCTAAGCGTTTGATCAGACCTACTTCCGTGCATGCCACTTGCACATTAAGCGTGGCCCATG
CTTTCTTGAGGATCTGGCGAACTTCCACGTCAATATCCTCGAAGTCAGCTGTTAACTCAGGCAGTTGCTTTTTCACTTCTTCAGACTGGATGAACAAAGG
CTCTAAGTAGCTCCACGACCGCTGAATGTcgcccagcagcaacacgacTTCATTGATAGACGACAGACCAATCTGAAGGCTTGCGACTCGAGGTTCAAAC
TCAGACTGATATGGTGATGCGCTCATGCCTTGTACATCGATTTGGTGCGTCTCAAGGAGCTCGAAGTTCTCTTCTGACACTTTCAGAAGTGGCACAAtat
cttcttcagcagcccCTGGATTGTAGGTAGTCATTTCCCAATTAACTTCAGCCCACAAAGCCTCGAGCTCGATCAACCTCAGCTCgagttcctgctcctt
ctcagcctcaTAACAAATCTCATTAATGTCGGAGCTGAAGTTGAACAAATTTTTGCTCATGATCAACGACAGTTTTTGGTTTGGGTCCTCATCGGGTGTA
GGGAACTCTCCCGTCTTCACCATGATACGCTTCCAGTGTCGTGGACGCATATAACTGGATGACACACAACGGATGAGAGGGTGTGTCTTATCAAACGCTT
GACACTCTTTCAAAATTGAAGTGTACGCATCACTCCACTGAATGCCCTTGGGAATCTTCTTTAACTCCTTCAGCGATGACTGAACTTCAATCTGGAGCGC
GTTAACATCCACCTCCTTAAACAAGATTTCCTGAGTATCCTTAAAAAACGCTTTTGCACGTTTGATAATTGCCCAGACGGTCTTCATCGCATCTGCATCC
GCACGCATGAGACCCATCATACGCAATGACTCATTCATGAGCTGCGGAAATCCAAAGGTGGAGCAAAGCTTCGTATTCTCCTCGCATTTTTTCATTTCCA
TGTTCCAATCGACGAGGTAGTTCTCGATCTTTTCTAAGCCCTTATCAGGCTCAAGGTTCGAGGACCAGAAGTCAAGGGTTTTGAGGGTCTCCATCTTTTG
CGCGATAGTCTTCTCGTATGCGATAATCTTCTCCTCAGTCTTTTCACTAAATATCCGAGTAGGCTCTTGGGTGCGTTTCTCAGTGAGTGGAACTTGCTTC
TCCACATCCACGAACAACTTCTCCATACTTTCAATTTCCACGAGCTCTTTGTCAACATGGCCACCATTTTTCTTGATATTGAAGAAAAGTTGCCGGACTT
GGTCCAGGATTAAGTGGTTCGTGCCCTTATCTATCTCCAGCTTGCGAATGATTTCTTTCATCTTTCGCAAGGTTTCAAGACCATCTGTATCATTACTCGG
GATGTCCTTCCGGAGATCAACAAGGATGCGCCGAAACTCTCCATTGCGTTTGTTCATCGTTGCCATCACACGCCGAATTAGGTCTGGAGAGTCGAGATCC
TTTTGGGTAGCTAACGGAGGCAAACACTTCGTCTTGTTCTCATCAGTCGGTTCCTGGAACAACGCTGTAAAGGGTGAGCCACGAATCGGGCCTTCAGCAC
CATTGAACGTTCCGGCAAAAATGACCGAGATCTCGTATTTCCCAGGCTTGGCCGGCGTAAATGTCACTACGTATGTGCCATCGTTTTTGTCAGTAATAGA
AATaatcttctcttcctccacgtGTGGGTCGTCGCAATACTTTAGTGTGATAATGAACTCGTCCCCACCGCAGTCCCGAGGATTGTCATCTTTATCTCGG
GCTTGCACGATAAATGTCGTTGGTACCTCGGCCATACAATTGTCGCTTAGCGCAGCAATCAGACAAGGTCCAAACGCCAGTGACTTCGGCGCCGCTGTTA
CTGAGTGGAAACGGAACGACGTGGAGACATTGGTATACATGCCACCTGATAGAGATACTCGAACTTCTGCTGACAAAGACCCGAATTTCTCGAAGCTTGG
GGCAGTAGCCTGAATGACAGTCGGGCTGAGCACGGTTCCAGTAACATCGACGGAACCTTTGGTCACTGCAAAACGCAGTGTCGCATTCTGACCTGTGAAG
TTGAACCCAGTGACTTTCACCTTCGCGCTTCCCGTGATTGGACCTTGTTTCGGTTCAATTGACGAGATCGAGTACGGAGGCCCTACAATCTCAGCTGCAT
TGAGTACATGCAGGTCGTTGTACCAGCGATTTGCCCAGCCACCGAAGAAGATCAAGTGGTTAGTGTTTGCATCAAACACCATCGAGGTATCCGCACGCGC
TTTCGGAAGCTCGCCTTTTACGGGTGGGCTTAGCCACACCATGCTGCCAGTGTCCAACACAGAAGTGCTATTTAAGTAAGCTCCTTGAGCTGTGCCAGAT
TCAGCTAGATCTCCACTGTTACCCCCGAACAGGAACACTTTCCAGTGAGGTACAGCCGCAACACTCACACAAGTGTGGTTCCAGATAGGAAATTGCAGCG
GCGTGGTCAATAAGCTCCATGTGCTGGTCGGCATGTCAAAAACAAATATGTCCTGGAActgcttgaagctgttccagcCCCCAATGACTAATAATTGCTC
CTTGACCAAACATGTCTGATGCCCCGACCGTGGTTCTGGCTTCTCGCCGTTGGCTTGAATTTCTTGCCATTTGTACGAATGTAAGTCCAAGGCGTGCAGG
TCATTGAAGTCGGTACGTCCAaagccattgccaccatAGCCACCAAACACGTACATTTTATCTCCGACAAGTGTGGCACTATGAGCACCTCGACATTGTG
GTAACCCTTCCCAGAAACCCTGGGCATATTTCTGTTCCCACAGTTTTAATTCTGTGTTGAAGAGCCAGAGATCGTTCATTCGCTTTTCAGCCGCGAAGCC
TCcaaagatgatgatattctTCTCGAATAAAATAGCTGAGTGTCTCCATCGTGGGGGTGGTGTTCCTTCCTCGGTATGCGAGCTTATAACCTTTGACCAC
GAGTAGCCTGCATGCAAAAAAATCGCATTTTATCAACAACACGAGCCAAAAGAATCTGCAACATGTTTGGTGCTTGAATCTACCATTTGTGACGTCCAGC
TTGTGGAGCTCGTCGGTAGGTCCTGGTGGTGATTTGTGATCACACCCACCAAACATGTATACGGCTGTTTCTGTCTCTGTGCTTTTCAAGGTGAAAGAGT
GTCCGGACCGCTTCACAGGTATTTCTCCGCCCTGCTTCGGCGCAATCCATGCCAGCTCCGGTTCGCATCCGTAGCCTATCGGCTGTAATAATTATAAGGC
TAAATCAGTGAAAACCACTCTTAAAAAGGCAGCGAACACCGACAAATatccacacacacaccatATTGTTCGTCCCTCCGAGGGATATCTAGGCCGCAAG
ACGCCGCACTTGGATTTTCTTCTCGCACTGTAGCTCCTCGTGACCTCAACTTCTTGGCTTTCTTACTTGCCCTGGAATTTGTCTGTCAACCCAAATGGAG
CCACAAGAGAGTAAAAAACTCCACACATTCAAGAGTCGCGACGGGTCATCGCCGCCAAGATATCCACCCCTTCAGTTAGGACGAAGCACATTACCAAGCT
GACAGAAATACAAGCAAAACGCTGAGTCATTACTCCTTCTGCGTGACGCAGCGCGTAGACGTCCATTGTGCTCAAGAGCTTGTTTTATTTCAATCGGGTT
GCTTTGTTCAGACCAACCCCGTTCTTCACATCACACACTCTTCAGACGCGGCGAcaatctgcagctgcaattcCAAACCACCAGAACACTCGCTGATAGA
GTGGTGGACCAAGTAGCAGACTGCTAGACCCACTCAACACCTCATGGCAGCAATATCTACCTAGttgttgaacttgaagaaAATGATGTCGCCATCCTGG
ACCTATTGCACGAGAGCACAAGCAAGGAAAAGAAGCACGAATGAGAACGATGTTCCGATCAAGTTAAGATATACACTGCTACGTACCTCATATTTCTTGC
CCTGCTGTTTGAGCTTGCCAGCCTTCTTCACGGCCTCTTCAGATCCCACTGCACATACcaacagaaaaaaataaGTTAGCTTGAGACACCAATCTACTAA
AATAAAACGACATGCAACAGTGAGCATCACAGATCGGCAAACGTACGCTCTTTCAGGTCAGCAAATGCCTGTACTTCAGCCATGATGAATCCCTTCTCGA
AGTCCGTGTGGATCACACCAGCAGCCTGGGGTGCCAGTCGACCCTTGCGAATCGTCCAACCACGAACCTCGTCCTTGCCGGCCGTGAAGAAGTGGATCAG
ACTCAGAGCCGAGTAACCCATCTTCAGCACACGGTTGAGGATGGACTTGTGCGTCGGGTTCTCCTTGAAGTATGTCTCAAGCTGGCCGCCAGCCTCCagg
tccagcagctccaactcgaATTCACAACTCAGAGGGATCACGGGCTCGTTGCCACCACGTTCCTTAATGTACTCGGCAATCTTGGGCAGGTACTTGTTAC
TCTTGCGCAGGTAGTCACGCTTGCTCACATTGATGAGGTACGCAACAGGCTTAGCcgtcagcagctgcatgGTGTTAAGGACTTCCACCTCAACGGCGCT
CCAGGTGCCGAACGACACGTCCTTTCCAGCCTCCAGCCACTCCTGGATGTGCACAAGCGCCTCATATtcgaccttcttctccttgcCGCCGACACCACgc
tccgccagcttcttaacaccagctgcctcctTAATGACACGCTCAATATCCTTGagacgcagctcctcctggATGATCTTCATGTCACGCACAGGGTCCA
CGTTACCCTCCACGTGGGTCACCTCAGTCGAGTCGAAGGCGCGCACCATGTGGTAGATGGCGTCCACCGCCTGGATGTGCGACAGGAAGGCGTTACCCAG
ACCggcaccttcagcagcaccacgcACCAGGCCAGCAATATCCGTGATGGAGATCACGGGGGGCACGACACTGGCAGGTTCGTACTTGTTCACGAGCCAG
TTGAAGCGCTGGTCCGGCAGAGGCACCACCGCATCGTTAGGGTCGATCGTGCAGAACGGGAAGTTCTCTGCTGGAATGTGCAGCTTGGACAAACAGTTGA
AGAAAGTACTCTTGCCCACGTTAGGAACGCCCACAATACCGATCTTGACGTTGTTACCGGGGCGACCCAGGTACACGCGTTGAggctgcaacaacaacaa
aaagtaaTAGATATTCGAGTGAGTTATGTTTGTCTGTGTGTGTATAGTCTTCTTTTACTACGACGTATACCTCGTCagtcttcttgctcttcggCGGCAT
GGTGTCG