Description :
From Genome Similarity Track
Location :
Scaffold_12:6368- 9635
Transcript NameFunction/comments
g4903.t1hypothetical protein

Sequence
3267 bases(100 bases per row)
GGGCACAGCTGTGCCTCGAGATCAATGGATTCCTGGATATCGCGAGCGCGTGCGACGCCCCGCTGCGGATGTCGCCCCGTGGGACGCTCGATACATGCGT
CGTATCAGTGTCCTCGAGTTGGATTTGGACTTGCTGTTCCATCACTTCTGTCGGCCACGTAATTGGTTGATTCCTGAGCGTGCAGCTCGTGCTCCACGTG
ATCATGCTTGGCGGTCAGATCTGATCACCGCGGCTCACGTCCGGGCGTTGTACGCGACGCGCCCCTGGGAGACTCTCCACACTGCCGTCACCCCGATTTC
GTTCGTGCTCGTGGGTTGGTTTGCAACCATGGCTCGTCAATATGCGGACCTGATACACGAGCATGCACAGGCCGTGTGGGAGTCGTTGCACTACTTCTCC
ATCAGCACCAGCAGTCGTCGCGGGGACGTTTACCTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAGTTCTTTC
TTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTCGATCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGGAGAAGAT
GTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGGTCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGAGTCCAATACCGCCAC
GACATCCGATCGCACCCCGCGCAACGCATTGCGCGTCTTCGTAGCAAATTCGTCATCCCAGCTTCCCCTTAAGCGTACACTTGAGTGTTAATCTGCATGT
AATTCCATTTTCACCTCTTTTTCTCCAGTTGTCTTCCTTGATCGGGTCGATCGAACCTCGTAATCGGTTCTCTCCCCCTTCACGCCACTAGTTTTTTGTA
CATATACCTCCTCCTTCTTTCTGAGTGCAGCCACCCTGCACCCAATTCACTCTCAACTCGCAGCGATCGTCACGAGTTGTCCTCCTTCTTCCTAAGTGCA
GCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCGCTACGAGTTGTCCTCCTCTGCCTCGTGCGATTGCATCACTCCGAAGCGATTCCGTCTAGT
ACGCTCGCGCTCAAACTCGTGCAGCAAAGCCCCGCAGTTGAGGTCAGCCTCATCGACCCAAGACGGTTCGGTGTATCCCTTCCAGAAGACCTGGAATTCC
CGATGGACGCGTCCATATCTGGTCTTACGACCCGATCGGACATCTGCGATCCGCTCCACTTCAAACTCGTCATCGCTCCGATCACCTTCCCAGCTGTCAT
CTGGCAACAACGCCTCATCAAAATCAAATCGACCACCCTCGTCCGTCGCTAGCGTTACGTCAGGACGATCAGGGAAAACCTTTACGGCCTTGAGCTTCGA
GACGTGTACAATCGGAAAAAGGCGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATCTCGCGCACCCGGAACGGTCCGTGCCAC
ATTTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGCGACCCGGCCTCAATCTGGTGCGGCCTTATCCCGTCGTTGT
GGCGATCGGCTCTTGCTTGGATCGCCTCTTTCAGACGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGAATACGATATCTCCATCTGCGCGG
CTCGCGATCGCGACGTCGCGTGCTGCCTAACGGCAGCGACGCTTCCAATGTCGATCGCGGGTCCCAGCCATGGACGAGGTAGAACGGCGTCTCTCCTCGT
ACTCGATCGTGAGCAGTGTTGATCGCAAAAGTCAGGCGTTCCGCGTACTCGTCCCAGTCTTGCTGATTCACATCGGCGACGTACATCTTCATGGCGCGGG
TAAGCGTTTGCACCATCCGCTCAACGGTACCGTTTGCTTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGCGCGGAA
GAAATCAGACATAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATGGTCTGCG
CTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACGAGGAGCTCCGTGTTGCCCTTGAACGATTTTGGCAGAGATGG
GATATGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGCCCCTTCCCTGTCTCGCAATCC
ACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGCCCCCGCCAGTGGAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCGATTCCCTGGTGCCCTC
CTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTTTAACGTTGCAGGTACCACCAGACGCGCGATCGAATCTCGGTCCTCGTCTAACCGGGTGGT
GTTCACACAGTAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCAATCTTGGCGCACGCTTTTGCATCCCTGGTAGTCAAGGCTGCTACGTCG
CCCCGTAGGTACGACTTCAGGTCCACGACCCACTTCTCTTCATCCTGAGCTTGTACTAACCTCTCACTCCTCATACGTTGGACGATCTCTTCTTGCATAG
CTGCCGGCACTTGACGGTGCCGTCGGGCTGATCGGGTCACTGCTGACACTTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACCCGCCCAGGTGGTT
GATCGTGACGAGATCGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCCGCACTTGCCAACCGATCGGCGCTCTGATTCCAA
TCGCGCTTCACATGGAGGAAATCGTGCTTCGGCCAAGCTTTCACTTGATCCATCGCTTTCTGGCGTAGTATCTGGAGACCCGGTGCCTTGCAATCGATTT
CACCACGCATCTGTCGGATGATCTGTCGGATGATCAGGTTGGAATCTCCACAGATCACGACTCGCCCCCTGTTCTGATCGGACAGTAGCTGGAAGCCTAG
CAGAAGTCCGCGATATTCGGCTTCGTTGACAGTCAGATCGTTGGCGAATTCGGATGCGGCAGATATGATCGACCACTCCGGGAGCCTCCAGACAATTGCA
CTATAAGCTCCGGCGCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAACTCTTCAC