Description :
From Genome Similarity Track
Location :
Scaffold_3:636609- 637981
Transcript NameFunction/comments
g18890.t1hypothetical protein

Sequence
1372 bases(100 bases per row)
AGGTCGTAGGACACTGCTCGCTGCCAAGGAAATTGTCCAGAGACTCACAGCTCTTACCGTGGCCATCACAGATCGCTAGAAAGCCTGAAACCAGGTCAAG
GATTGCAATCATTAAATATTAGTTGGCCTTCCTTGATGTTTCTGACGCGCTTGTCTCCAAACGCCTTGTTGTCGCTAACAAATAAAACAATTAAAAAAAT
ACTTCGAAATATAAGTATTAGTCAAAAATCTTAGGCAACTTCACCAGTATTACTTAGAAGTACTACATACGCCAATTTCACAAGCTACCGTAAAGAAATT
ATTCAACTACCGGTCATACTTGTATACCGCTCTAGTTAACCACAGGAACCGCCAGGAAAATGTATAATGTCTTCGGGTTTTGTGCAGCAAAATGGGTAAT
TTATCTCCATTTTTGCAGGGTGAGGTTACTACAATCCTTAGCTCTCATCATATTATGTGCTTCAGTGGAAGTATTATGGTTGGCAGCGTAATATGATAGA
CAGCGTAAGCACTTCTACGGATGTGTACATTGTACCCACCGGTACGCGGAACCAGTCCTTATTCCAGAATTTGCTCCACCGGTGCCACTTGCTCACATCC
AGCCAACTGGATCATCACAATGCGTGCGTGCTCCATCCTTCTGCTGGGCGTAGTTGTCCTCCTGGAAGCTGTGACGACAACTCTAGTCTCAGGCCAGACA
AAATTGGAGAGTGGGGCCTCGCCCGAGACGCCCCAGTCGTTGGATATTGCACAAACCGACGACAACACCAAACGGGCCCTGGGGAACAACTGGACGACCA
ACGTGGCCTTTAGGAGCCCCGAAGAGAGAGGGGTTCCGGGCTTTAAGAAGATTCGCAACGGTCTAAAAATATGGGTCGACAAGGATAGGAAGTTCGTGCA
GATGCTTACTGGTGGTGCGGCGAAGGACTCCGCGCTCTTCGCAAAGCTCTACACCAAGAAGGCAATCCCCTCCAGGATGTTCACCAAGATGAAATTGTCC
GAACTTTCCGTCGCAGAAAAGAAGACCGATGAGGCTTATCTGAAGTGGGCCGCGTACTTCGACTATTGGGTTGATAGAAATACTGGAAAGATTAAAGCAT
AACGAAGGTTCATCACTGAGATTCCGTTGTTGCTAGTATTTACCACTCAAAATGGAGTACTACTGTAGCCCTTGAAAAACAAAACCTCTGGATACTACTG
CAATAGTAATATAAAAACACGGTACTTTGATTTAAAATATAATAGTGTTATTATGCAGAAAAAAGTTAGAGTTCAAAATATAACAATAATAATAATGTTT
TATTTACATTTGTGTGCAAGTTATATATTACTATATTTAGAACCTGCAAATGAATAAAATATAGCATTTAAA