Description :
From Genome Similarity Track
Location :
Scaffold_279:6366- 8125
Transcript NameFunction/comments
Hyaar_Emoy2813456CorA Metal Ion Transporter (MIT) Family putative

Sequence
1759 bases(100 bases per row)
TTTCGCATCGAGTCAAGCTTCAGCATCACCAAACTCTCAGTATTCGTGATGCGGTGCTGCATCAGATCGGCCTGCGTGCGCGTGGAAAAAATGTCTTGAA
GGTAATTCTCAATTAAAACTTCAGCTTCCTCCGAGTCAAAACTGTACAGGTCCGTGAGAAGAGAGGGGTCTTCGTAAAGCTTAGTCAGGTACAACAAGCG
AAGGTCCTCTTCGTTGTCCAGCAACTCCATCAGCACGCGACGTACACCATCTACTTGAGACTCAAACTCGTTCATAGTGTTTTTAAACTCGCGGAGCGTC
TCCAGTTCGCGTGAGTGAAGATTTCCTTGCACAAGCCGGTCCAGTGCCGAGACCACGACAGGAAAAAGCTTCTCGTAGTCTGCTTGAAAGTAACGTGCAA
GTGTTGCAAGCAGCGCTTCCAGGGCCCTTCAATACACCGATTAGTCAAATCCTTGTTACCAATAAACTTTGTTTCTAATCTGCACAAACCTGAACTCATA
CGGATCTTCTGCATTTTCCCGGGCAGCTTGACCAAATTTCTCCTTCAAAATAGACAACAAACTATCCGCTCCATCAGGGACGTAAACAAGACAAACGTCT
CGCATCACAATCGCCCGCAACGGATCTAAAGGTCACAGTCACGATCAGTTCTACCATCGACGCCGACACTTTTCCAATCATTTGTCGTACCAGCGCTGAT
GAGAATCGCTTGCTTTCGAATGATGATTGACGGCTCGTTCGATACTGAAAATGCATTCTCCATTCGTCGAATATCCCGTGCGTGAACTCGCTGTACTTAC
ATCAAACAAAAGTGTCACTACAAGCCCTCTCCCATCGCCACGTCTGCCCCTCCTATGTTACCTCCATCCGCTCACCTGTACGTCACAGACGGTGGCGTAA
CTAAGTTCCACCCCTCCAGAATCCCCATACATTCCATTGATGCTGCCTCGCCGTCCCTTAGTGCCCAGACTTCCCAGTCGCCGCATCGGAGCTGTGGCGA
CGTTCAGAGATTCGCCAGCGCCATCCGGCTCCCCTTTTTCCACGGCTGCTTGCCGCGTCATCCTCAGCACATCCAGTCGGCTCATTTCTTTGAACTCCGA
GTCTCCGTCACGGTCAAAGAGCAGTACCAACACGCGCCCGTTCTTCGAGCCGGGGTCGAACTGGCACGCAAAGCGCTTGAGAGAGCTGGTGCCTGGCGAG
CTGGTGGTGCTCATCTCTGTCGAGTCTTTCGTGCTCTTGTTGACGCGGTGGTAGCTGGTCGCGGGGCTTTGCACGTCGATGGTATGGGGCTCCATGGCGC
TGCTACTAAAAGACGTCCGGGACGTTGACACGCGCGATGCTTTTTCGGCATACGTGGTCTCGTGTCCGTGGTTGGTCTGAAATTATAATTTGACATCTCT
CAAAGATGTTCATGTATTTCGTTTCTCAGGACAGGTGTAGCTCGATATGATTGGATCGAAATTTCTCGTTTGTGTCCTGTCGACAGAAAAGGGGTATTTG
GAGCAAAAATGTCAGTTATGTACAACCACGTGACCGTACGAAAAATAGTTGAAGGGAGAGAGTACTACGAGTACTGAAACCATCTCGATCTTTCATGTAG
AATAAGACCCAAGTCAGCCTGTTCTCTCACGCGGCGCATACGATGGACGCATGTGGTAATCCAAGCGGTATTAGAGAGTAGATTACAAGTATATAAGTTT
GCGCACGATTTGCACGCAGCCACTTCGAGGAAAAGCGTACTATCTACTTCATTTTATGT