Description :
From Genome Similarity Track
Location :
scaffold_5:636302- 637369
Transcript NameFunction/comments
g8234.t1 hypothetical protein PHYSODRAFT_349530
g8235.t1 hypothetical protein PHYSODRAFT_476401

Sequence
1067 bases(100 bases per row)
GTTTGCGGAGCTGTACATCGGTCATCCAATCTTCCAGGGTAAGACGGAGCTCGAGCAGATCACCAAAATCTTTGACATTTGTGGCACCCCGACTACGGAG
TCTTGGCCCGACTACAAGTTCCTGACGCACAGCAGTACGTTCGTCCCCGATAAACCAAAGCCCAAGCGTCTGCGCGAATTTCTGATGCGCGAAACTACGG
CGCGTAAGAGAATATTGCCGAAGGGCGCTCTTGAACTGATCGAGGCGCTTCTGGTGTTGGACCCGGAGCAGCGGTTGACGGCTTCCGACTGCCTCAACTC
ACAGTATTTCAAAGCCCGCCCGTATGCTCCGAGTGACCCAAAGAAGCTCCCTCCTATCACAAACCTTCCGCCATCGCATGAGTACCAGACGAAGAAAATC
CGTCGGGAGCAGGCAAAGCAGCTGAACGGTGGAGGTGCTAACAATCATAGCAACAACAACACTGGGGCCAGTGGTGGCCGGGCTTCACGTGCTGCGAGTC
CCCCCGGTGCGAACAGTGGGGGCCGATCTAAGCAGAATACTGCGAAAGAGAACACCAAAGTGTCGGTGAAAACAGAAGTCAAGCGAGAAGAAGACGGCCG
CTCCCCGAAGGGCCAACCATCATCTGCGAAGAAGAGACGGCGTGTGGCATAGCAGAGCGTTGATGAAGCGGAGATCATGAAAATGGCCCTGTGATCACAT
TAGTCAATATGCAATTTCCGAGCGGTGGGTCACCCAATTCTTAGTGCTTTGAATATACGCGAAAAGGACTGAAGAAAGGTGTGGTAAACGCGGATTCATT
GCGCCATTAGGGAGAAGAAGGAGGCCTGCCGTGCAGTTGTCAGTGCGTGAGGTAGCGGTTCCGGGACGACGATGGCGACGGGACTGTCTTTTGAAGCTAA
GACATAACGGATGCACAGGAGGCAAGCCGGCAGCGTCAGCAACTTACAGCGGTGATACAGCCATCAAGAACAGTTTTACCTGCAGCAGTAACGACGGGTT
TTTAGTCTTGACAATGCTGTTGACCTCCTGCAGCCGGACAAAGGGAAATGTGACGTGTTAGTTGTAA