Description :
From Genome Similarity Track
Location :
Scaffold_44:63627- 65113
Sequence
1486 bases(100 bases per row)
AAGACGCGCAGCTCCCTCCGCACGTGTTCTCGATGGCGGAGAGTGCTTACCAGTCTCTTCGACGCCGAAGACGCTTGTCGAGCGAAGCAAAGAAAAaTCA
AACCATTCTCGTAAGTGGAGAAAGTGGTGCTGGAAAGACAGAGAGCACCAAATTCATCATGCAGTACCTTGCTGAAGTCTCGACCCCAGTTGATGTCAAA
GGTAGTGATGCAGCTTCAGTTCCAGATCTCACCAAGTTTCTGCTTAGTGCAAATCCGATTCTCGAGTCATTTGGTAATGCCCGCACGCTCCGTAACAACA
ACAGCAGTCGCTTCGGCAAGTTCGTTCGTATGTTCTTCAACGAaCCCAATGAAGGCCCATCAGCAAGTCAGCATCTACAGATGGTCCGATCCACTGTCGA
GACGTATCTCCTCGAGAGAGTTCGTGTTGTCCATCAAGGTCTGGGAGAACGTAATTtCCACGTGTTCTATGAACTTCTTAAAGGCGCATCTCCCGAGATG
CGAAAGGACTTACTTCTGATAGATTTGCAAGCGAAAGACTTCCAGTATGTGAATGTTGGGCGGTGCTACGAGAGAAGTGATCGCGTATCGGATGCACAAC
AGTTTACCAAaGTATTGGAAGCCATGCAAGTGATTGGTTTCTCGCCCGCTGAACAGCTTTGtATTTGGAAGATTGTCAGTGCTCTTCTACACCTGGGGAA
TGCGGGATTTATCCCAACCACTGGACACGAAGATGATGATCCAGCTAATGCACCACCATGTATTCCAGCAGATTCATCTGCGTCGAAATATTCTTCTCGT
GAGCACCTGGCAATGGCTTCGCAGCTTTTGTCCATTGCGGAGGTAGAACTTTTGTCGAGCCTGACAGTTCGAACAATCAACGTAAGCGGCGAGACGTATC
AAGTTAAGTTGTCGCAAGCACAGTGTTGTGATACACGTGACGCTGCTGCTCGATCACTTTACGGATGGGTTTTCCAGTATCTTGTGAAACGTATAAACGA
CACATCACCTGATCAACCAAATGCAACCACGAACACAGGTGAAGAAAAaGGGGACCAGCAGCCTTGCATCTCTGTTTTGGACATTTTTGGCTTTGAGGAG
TTTGATGTCAATCAGTTTGAGCAGTTTTGCATCAACTACGCGAACGAGAAATTGCAGTATCAATTCATTAAGGACATTCTGGAGTCAGAGCAGAACGCTC
ACATACAGGAAGGAGTAAAaTGGGACCCAGTTGATTATCAAGATAACGCATTATGCTTGGAAATGATTGAGCAAAAGCCcAGCGGAATTTTCAGCCTGCT
TGATGAAGAATGCCTCATGCCAAAaGGAACTGATGCTAGTTTTGCACGCAAGATGTATCTTCAAATGAAACAACATCCAAGCTTCTTGGCTTCCAGCAAA
GATCAAGTTGACTTCGCTTTTCAAGTCAATCACTATGCTGGTCAAATCAAGTATATGACGACTGGTTTCTGCGAGAAGAACAAAGA