Description :
From Genome Similarity Track
Location :
Scaffold_60:636267- 637674
Sequence
1407 bases(100 bases per row)
ATCGCCATGTTGACCCCTGGTCAAGTGCACAGGCGCTGTGCACTCCCGCGCAAAGTGTCCGGTGTACCCACATCGGTAACACTGCACTTGTCCCCCAATA
CGCTGTTGGCGTCCAACAGCGGAATCGTTCGAGAGGTCCATAGGCTCTGGACCTCCCGCTCTCATCATCGGACGTGCCATCCTCAGTACGTTCGCATGCA
GCTTAGTCTGCTTCAGGCTAAACTCCTCTTTCATTGCAAGAGCAATCGCAGCTTCGAGAGTACTTGGGTACGTATTGAAGAGATAGGTCTTAACCGACCC
ATCATTTAAGCCCGTCATGAACGTGACGACCTTTGTCGCCTCGTCGATCGGGATGGTCACGATGTTCGAGACCAAGTACCGTACACGTTGGGCGTAAGCA
TGAACGTCATGCTTATCTTGCTGCAGATCGAGAAACTCTGCTCTCGCCCGGAACTCATTCTAAGGGGATCAAACGCTTGTCTGAGCTCCTTCTTGAATAT
CGCATACGTGCTAAAGCACGTATGGTCTGTGAGCCGGCGGCCATACGCCCAGCTCCTCGCTCGTCCGCCAAGGCATGACATGGCGAGCGTAACCTTCGAC
GGTTCGTCAGTGATATGACGAGCCGCTATGGCAGTATCGAGCTCGACAAGCCATCTAAGAAGAGGCTCACCCTCTTTCCACACGTAACGGCTCACATGCA
GTTCCAACGACTGCATGCGCGGTGTCGTTCCGGACGACACTTTCCTAGCAGCAGCATCGCGCTGCTCGCTCACGATGAATTCCAGAGCAACATCGTGTTG
CTCTGTCGGCGACAGCGTATGTAGTATTGTCGCTACGGCTGCCTCTCCAATGACTGTTGGCAGTCATTGGAGAGCTTCCCACTCTGGATCCTCCAGATGG
GGACAGTCTGCACGCACAATGTGCGTGGCAGAAGCATTTGGGCTACGCATGGACGGATTACTGTCCATGGGTTGGTTCTCCGCCCCGTGTTCGTATTCCA
TACGAACTCTGTAGCCAGTGGGTCGTTGGACGGACCAACAAGTGCTACCAGGTGTAATGGGCCTACTCTAAGCCCAATACTTCGGCTTACACGTTAGCGC
ACGTGTATGAGGAAGCGTAAGTTGCGTTTCACTTAGATTAACTATACTTTCGTCCGAAAGTATAGATTTACTTTAGAAGGAAAGTAAAGCCAATTTATGG
TAAAATGAGAACTGTTTATTTGTTTGTTTAGGTTTTCCTCCTAATATAATATTCTAAATGAAAGGTATTTATCAGCGAATGGTTGACATAATCCTATTAT
TCTACTTAGTTGAAGATATTGATTTTTAACCAATGAATGCCATTTAGTGCATGCAGACCAACAGTCTGTCAAATGAAGCCATTGATGTATCTCACACCAA
TGTGGAA