Description :
From Genome Similarity Track
Location :
Scaffold_26:63626- 64757
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009536Similar to 73: Immediate-early protein (Saimiriine herpesvirus 2 (strain 11))

Sequence
1131 bases(100 bases per row)
AACGATGGTGCATATGCGCAAGACGTTGGCGCTGGCGGTGGTCGCGACCGCATTGGCGCTCTCCGCGGACGTGTCCGTCGCCTCGAACAGCAAGTCGGTG
GCCTCGCACCCGCACGCGCACCACCACAAGACGCACCACCAGGTCGTGCACCACCACCATAAGTCGCACCACAAGCCGGCGCCACCGACCACGCAGCCCC
CAGTCGAGTACGAGGAGGAGGACAGCAGTGACTACGCCAGTGGCAGCGCTGAATACGAAGACAGCAGCGACTACGCCAGTGGCAGCGCTGAATACGAGGA
CAGCAGCGACTACGCCAGTGGCAGCGCTGAATACGAGGACAGCAGCGACTACGCCAGTGGCAGCGCCGACTACGAGGGCAGCAGTGAGTACGAGCACAAG
TACAACCCAGCGCACGCGACCCCCGGCCCTACTGACGTGTACGGCAGCCTCGCCGGCTCGGGCTACGTCGACATTGATGGCTCGGGCAACTACGAGTTCG
ACAGCTCGGCCAGTCTGGACTCGGACGACATCTACGAGCTGGAGGGCAGCCTCGAAGACGGCAGCGTCGACGTGGAATACAGTGACTCCGAAGACTACGA
CCAATCGCTGGACTTGTCGGATGACCAGACGCTCGATGAATCCATTGACCTGCCACAGGGCGCCAAGAAGGTCCACCTCCGTGTCCACAACGGCCAAGTC
GAGCTCGACATTATCAAAGAGGCTCCAGCTCAGAAGAAGGAGCCTGTTGCTTTTCCTGCCGAGACGCCGAAGAAGGAAGTTGCTACGGCCGCTCCTACTA
CGGTCGAGAAGGTTGAGACCCTCGCCAAGGAAGGCATGGAATGGGTCGAGAACAACAGCAACAAGCCAGCGTTCCTCGCCGGTGCTGTCGGTGCCGCCGT
GGTGATGGTCGGTGTTGCTGGTGTGGCAATTGCCAAGAGCCGCAAGCGCTCGGCGCCAACGTCGGCCCTCGACGTTGAAGCTGCCGAGGCTGACGCCCAG
GCCGCCACGGAAGAGCAGGACGAAGAGGCTGATGAGAACGAGTCTTCGAGCGACGAGGAGTCGGCCGACGAAGCCGAAGATACCGAAGAGAAGAAGGAAG
CCGCTGGCGTCGTGGAAGGATCGGTCTAAGT